ID: 1125000280

View in Genome Browser
Species Human (GRCh38)
Location 15:34762757-34762779
Sequence CGTTATGTTTAGGCTGGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125000277_1125000280 -9 Left 1125000277 15:34762743-34762765 CCGATGCATATAAACGTTATGTT No data
Right 1125000280 15:34762757-34762779 CGTTATGTTTAGGCTGGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125000280 Original CRISPR CGTTATGTTTAGGCTGGACA CGG Intergenic
No off target data available for this crispr