ID: 1125001158

View in Genome Browser
Species Human (GRCh38)
Location 15:34771231-34771253
Sequence CTGTAGTTATTTTAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125001158_1125001160 17 Left 1125001158 15:34771231-34771253 CCATCTTCCTAAAATAACTACAG No data
Right 1125001160 15:34771271-34771293 AACAGATAGAGTTTATATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125001158 Original CRISPR CTGTAGTTATTTTAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr