ID: 1125004214

View in Genome Browser
Species Human (GRCh38)
Location 15:34799588-34799610
Sequence CCCAGTGCCGGGGAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125004214_1125004223 16 Left 1125004214 15:34799588-34799610 CCAGCCTCCTCCCCGGCACTGGG No data
Right 1125004223 15:34799627-34799649 ATCTCAGCTGTTCCTCCGTTCGG No data
1125004214_1125004224 19 Left 1125004214 15:34799588-34799610 CCAGCCTCCTCCCCGGCACTGGG No data
Right 1125004224 15:34799630-34799652 TCAGCTGTTCCTCCGTTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125004214 Original CRISPR CCCAGTGCCGGGGAGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr