ID: 1125004223

View in Genome Browser
Species Human (GRCh38)
Location 15:34799627-34799649
Sequence ATCTCAGCTGTTCCTCCGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125004220_1125004223 6 Left 1125004220 15:34799598-34799620 CCCCGGCACTGGGGGATTAGCAG No data
Right 1125004223 15:34799627-34799649 ATCTCAGCTGTTCCTCCGTTCGG No data
1125004219_1125004223 9 Left 1125004219 15:34799595-34799617 CCTCCCCGGCACTGGGGGATTAG No data
Right 1125004223 15:34799627-34799649 ATCTCAGCTGTTCCTCCGTTCGG No data
1125004214_1125004223 16 Left 1125004214 15:34799588-34799610 CCAGCCTCCTCCCCGGCACTGGG No data
Right 1125004223 15:34799627-34799649 ATCTCAGCTGTTCCTCCGTTCGG No data
1125004212_1125004223 17 Left 1125004212 15:34799587-34799609 CCCAGCCTCCTCCCCGGCACTGG No data
Right 1125004223 15:34799627-34799649 ATCTCAGCTGTTCCTCCGTTCGG No data
1125004221_1125004223 5 Left 1125004221 15:34799599-34799621 CCCGGCACTGGGGGATTAGCAGT No data
Right 1125004223 15:34799627-34799649 ATCTCAGCTGTTCCTCCGTTCGG No data
1125004218_1125004223 12 Left 1125004218 15:34799592-34799614 CCTCCTCCCCGGCACTGGGGGAT No data
Right 1125004223 15:34799627-34799649 ATCTCAGCTGTTCCTCCGTTCGG No data
1125004222_1125004223 4 Left 1125004222 15:34799600-34799622 CCGGCACTGGGGGATTAGCAGTC No data
Right 1125004223 15:34799627-34799649 ATCTCAGCTGTTCCTCCGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125004223 Original CRISPR ATCTCAGCTGTTCCTCCGTT CGG Intergenic
No off target data available for this crispr