ID: 1125006083

View in Genome Browser
Species Human (GRCh38)
Location 15:34819694-34819716
Sequence GAGCTAGCTGCCACGATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125006082_1125006083 -3 Left 1125006082 15:34819674-34819696 CCAAAGTAAGTTGCTGGCTTGAG 0: 1
1: 0
2: 1
3: 13
4: 255
Right 1125006083 15:34819694-34819716 GAGCTAGCTGCCACGATGAAAGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125006083 Original CRISPR GAGCTAGCTGCCACGATGAA AGG Intergenic
903145366 1:21368641-21368663 GAGCCACCTGCCACGGTGCACGG + Intergenic
905252396 1:36658034-36658056 GAGCAAGCTGCCCAGATGACTGG - Intergenic
911084976 1:93968754-93968776 GAGCTCTCTGCCAGGATGCAGGG + Intergenic
920379417 1:205527116-205527138 GAGCTACCTGCCAAAATGCAGGG + Intronic
921591129 1:217004821-217004843 AATCTAGCTGCCATGATAAATGG + Intronic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
1070102078 10:73398028-73398050 GACCTAGCTGGCAAGATGGAGGG - Intronic
1071836552 10:89424019-89424041 CAGCTAGGTGCCATCATGAAAGG - Intergenic
1077539371 11:3139392-3139414 GAGCAACCTGCCAGGATGATGGG + Intronic
1084889119 11:72228106-72228128 GAGCTTGCTGGCAGGAGGAAGGG + Intronic
1099825145 12:87766832-87766854 GAGCTTGCTGACAAAATGAAAGG - Intergenic
1102862899 12:116351818-116351840 GAGCTCGCTGGCAGGATAAATGG + Intergenic
1104469634 12:129019130-129019152 AAACCAGCTGCCACGTTGAAAGG + Intergenic
1104957112 12:132472407-132472429 CATCTAGCTGCCAAGATGAGAGG + Intergenic
1106154248 13:27137865-27137887 GAGCAAGCTGCCGCGCTGAGAGG + Intronic
1112683987 13:101801785-101801807 GAGCTAGCTGCCTCCCTGAGAGG - Intronic
1117284378 14:54272565-54272587 GAGCAAGGTGCCAGGCTGAAAGG + Intergenic
1117624106 14:57618221-57618243 CAGTAAGCTGCCACGATGACTGG - Intronic
1119968858 14:78947171-78947193 GAGGTAGCTGCCACACAGAATGG - Intronic
1125006083 15:34819694-34819716 GAGCTAGCTGCCACGATGAAAGG + Intergenic
1125693707 15:41617727-41617749 AAGCTAGCTGCCATGTTGTAAGG + Intergenic
1131407173 15:92174842-92174864 GAGCCAGCTGCCAAGCTGAGGGG - Intergenic
1131523357 15:93133553-93133575 GACCTAGTTCCCACCATGAAGGG - Intergenic
1150155102 17:62846409-62846431 GATCTAAATGCCACAATGAATGG - Intergenic
1151451127 17:74198962-74198984 GAGCTAGAAGCCACGAAGAAAGG - Intergenic
1155705317 18:28803223-28803245 GATCTAGCTGCCATGTTGTAAGG + Intergenic
1164520446 19:28975135-28975157 GAGCAGGCAGCCACGCTGAAGGG + Intergenic
1165008994 19:32829779-32829801 TATCTATCTGCCAGGATGAATGG - Intergenic
1166919349 19:46218329-46218351 CAACGAGCTGCCAGGATGAATGG + Intergenic
1166928999 19:46289830-46289852 GACCTAGCTGCCATGATGTGAGG - Intergenic
1168463582 19:56583448-56583470 TAGCTAGGTGCCACCATGACTGG - Intronic
925269381 2:2591481-2591503 GAGCTGGCATCCACGATGCAAGG - Intergenic
928256453 2:29727113-29727135 GAGCCAGCTGCCCTGATGGAAGG - Intronic
938342778 2:130546572-130546594 GGGCTATCTGACACGAGGAAGGG - Intronic
938347055 2:130574150-130574172 GGGCTATCTGACACGAGGAAGGG + Intronic
941039748 2:160607836-160607858 GAGGCAGCTGACACGAAGAAAGG + Intergenic
945484265 2:210376328-210376350 GAGCTAGCAGCCAGAATGCAAGG + Intergenic
1169848767 20:10026609-10026631 AAGCCAGCTGCCACGCTGTAAGG - Intronic
1172886618 20:38235506-38235528 GAGCAAGGTGCCAAGATGGATGG + Intronic
1178160989 21:29914324-29914346 GTGCTAGCTGACAAGATGGAAGG + Intronic
1178594097 21:33937175-33937197 GTGCTAGCTGGGACCATGAAGGG - Intergenic
1182292442 22:29291400-29291422 GAGCAAGCTGCCCTGAAGAAAGG + Intronic
1184610871 22:45602307-45602329 GAGCTGGCTGCAAGAATGAAAGG + Intergenic
949151035 3:767201-767223 AAGCTAGCTGCCACTATGTGAGG - Intergenic
952072940 3:29661066-29661088 CAGCTACCTGCCACGAGGATTGG + Intronic
953629118 3:44597259-44597281 CAGGTAGCTGCCTCTATGAAAGG + Exonic
959800843 3:110494105-110494127 TAGCTAGCTGCCATCATCAAAGG - Intergenic
963738979 3:149055946-149055968 GAGCCAGCTGCCACGATGTGAGG + Intronic
980718482 4:136660095-136660117 GAGGGAGCTGCCCCTATGAATGG + Intergenic
988819444 5:34866767-34866789 GAGCCAGCTACCAAGATGATGGG + Intronic
989437548 5:41432613-41432635 GAGCCAGCTTCCAAGAGGAAGGG + Intronic
991246463 5:64513580-64513602 GAGCCAGCAGCAACGATGTATGG + Intronic
1012382953 6:98642070-98642092 GAGATAACTGCTAAGATGAATGG + Intergenic
1015085088 6:129280966-129280988 GTGATAGCTGCCAAGATGACAGG - Intronic
1015376513 6:132516151-132516173 GAGCTAGCTGCTGGGATGGAGGG - Intergenic
1016842549 6:148538842-148538864 TAGCTAGTTGCAATGATGAATGG - Intronic
1019869279 7:3743855-3743877 CAGCTATCTGCCCCCATGAATGG + Intronic
1021189022 7:17599100-17599122 AAGCAAGCTGCCAAGTTGAAAGG + Intergenic
1024343108 7:48286960-48286982 GTGCTAGGTGCCACAATGACAGG + Intronic
1031794290 7:126151884-126151906 CAGCCAGGTGCCACGATGACGGG - Intergenic
1032983631 7:137313505-137313527 GAGCTAGCTCCCACAATTACTGG - Intronic
1033337976 7:140469575-140469597 AAGCTAGCTGCCAAGCTGCAAGG + Intronic
1042962168 8:74315374-74315396 GAGCTAGCGGGCAAGAAGAAGGG - Exonic
1043916968 8:85934129-85934151 AAGCTAGCTGCCACGTTGTGAGG - Intergenic
1048495200 8:134929471-134929493 AAGCCAGCTGCCATGTTGAAAGG + Intergenic
1052343361 9:27384451-27384473 CAGCTAGTTGCCAAGATGAATGG - Intronic
1055680619 9:78711430-78711452 GAGAGAGCTGCCATGATAAACGG - Intergenic
1061343742 9:130004921-130004943 CAGGTAGCTGCCACCATGCATGG - Intronic
1195498094 X:105561305-105561327 GACCTAGCTCCCAAGGTGAAGGG - Intronic