ID: 1125006370

View in Genome Browser
Species Human (GRCh38)
Location 15:34822256-34822278
Sequence CCTCACATGCTGAAGCGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125006370_1125006375 7 Left 1125006370 15:34822256-34822278 CCATCCCGCTTCAGCATGTGAGG No data
Right 1125006375 15:34822286-34822308 GTGTTAAGAGCCCAGAATTTGGG No data
1125006370_1125006374 6 Left 1125006370 15:34822256-34822278 CCATCCCGCTTCAGCATGTGAGG No data
Right 1125006374 15:34822285-34822307 AGTGTTAAGAGCCCAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125006370 Original CRISPR CCTCACATGCTGAAGCGGGA TGG (reversed) Intergenic
No off target data available for this crispr