ID: 1125006784

View in Genome Browser
Species Human (GRCh38)
Location 15:34825419-34825441
Sequence AGCTGTTTGGACCAGTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125006784_1125006787 29 Left 1125006784 15:34825419-34825441 CCCTGGGACTGGTCCAAACAGCT No data
Right 1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125006784 Original CRISPR AGCTGTTTGGACCAGTCCCA GGG (reversed) Intergenic
No off target data available for this crispr