ID: 1125006785

View in Genome Browser
Species Human (GRCh38)
Location 15:34825420-34825442
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125006785_1125006787 28 Left 1125006785 15:34825420-34825442 CCTGGGACTGGTCCAAACAGCTA No data
Right 1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125006785 Original CRISPR TAGCTGTTTGGACCAGTCCC AGG (reversed) Intergenic
No off target data available for this crispr