ID: 1125006787

View in Genome Browser
Species Human (GRCh38)
Location 15:34825471-34825493
Sequence TTGAATATACAAATAAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125006784_1125006787 29 Left 1125006784 15:34825419-34825441 CCCTGGGACTGGTCCAAACAGCT No data
Right 1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG No data
1125006785_1125006787 28 Left 1125006785 15:34825420-34825442 CCTGGGACTGGTCCAAACAGCTA No data
Right 1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG No data
1125006786_1125006787 16 Left 1125006786 15:34825432-34825454 CCAAACAGCTATTACATCACATT No data
Right 1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125006787 Original CRISPR TTGAATATACAAATAAAAAA TGG Intergenic
No off target data available for this crispr