ID: 1125011636

View in Genome Browser
Species Human (GRCh38)
Location 15:34883169-34883191
Sequence CATGAAAGAGATGAAACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 495}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125011635_1125011636 -6 Left 1125011635 15:34883152-34883174 CCAGCAGAAACTGGAATCATGAA 0: 1
1: 0
2: 1
3: 18
4: 252
Right 1125011636 15:34883169-34883191 CATGAAAGAGATGAAACCCAAGG 0: 1
1: 0
2: 1
3: 36
4: 495
1125011633_1125011636 6 Left 1125011633 15:34883140-34883162 CCACAAGTTTTTCCAGCAGAAAC 0: 1
1: 0
2: 0
3: 24
4: 237
Right 1125011636 15:34883169-34883191 CATGAAAGAGATGAAACCCAAGG 0: 1
1: 0
2: 1
3: 36
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125011636 Original CRISPR CATGAAAGAGATGAAACCCA AGG Intronic