ID: 1125011636 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:34883169-34883191 |
| Sequence | CATGAAAGAGATGAAACCCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 533 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 36, 4: 495} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1125011635_1125011636 | -6 | Left | 1125011635 | 15:34883152-34883174 | CCAGCAGAAACTGGAATCATGAA | 0: 1 1: 0 2: 1 3: 18 4: 252 |
||
| Right | 1125011636 | 15:34883169-34883191 | CATGAAAGAGATGAAACCCAAGG | 0: 1 1: 0 2: 1 3: 36 4: 495 |
||||
| 1125011633_1125011636 | 6 | Left | 1125011633 | 15:34883140-34883162 | CCACAAGTTTTTCCAGCAGAAAC | 0: 1 1: 0 2: 0 3: 24 4: 237 |
||
| Right | 1125011636 | 15:34883169-34883191 | CATGAAAGAGATGAAACCCAAGG | 0: 1 1: 0 2: 1 3: 36 4: 495 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1125011636 | Original CRISPR | CATGAAAGAGATGAAACCCA AGG | Intronic | ||