ID: 1125023721

View in Genome Browser
Species Human (GRCh38)
Location 15:35009852-35009874
Sequence CTGTCACCCAACTCAGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125023718_1125023721 22 Left 1125023718 15:35009807-35009829 CCTTATTTATTTTTATTTTTTAT No data
Right 1125023721 15:35009852-35009874 CTGTCACCCAACTCAGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125023721 Original CRISPR CTGTCACCCAACTCAGAGTC TGG Intergenic
No off target data available for this crispr