ID: 1125024209

View in Genome Browser
Species Human (GRCh38)
Location 15:35014091-35014113
Sequence ATTTCGATGCTGAAAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125024204_1125024209 -1 Left 1125024204 15:35014069-35014091 CCCAAACCAGCTAAGATGGGGAA No data
Right 1125024209 15:35014091-35014113 ATTTCGATGCTGAAAGAGGGAGG No data
1125024199_1125024209 27 Left 1125024199 15:35014041-35014063 CCCAGTTTATGGTATTTTATTAC No data
Right 1125024209 15:35014091-35014113 ATTTCGATGCTGAAAGAGGGAGG No data
1125024200_1125024209 26 Left 1125024200 15:35014042-35014064 CCAGTTTATGGTATTTTATTACA No data
Right 1125024209 15:35014091-35014113 ATTTCGATGCTGAAAGAGGGAGG No data
1125024206_1125024209 -7 Left 1125024206 15:35014075-35014097 CCAGCTAAGATGGGGAATTTCGA No data
Right 1125024209 15:35014091-35014113 ATTTCGATGCTGAAAGAGGGAGG No data
1125024198_1125024209 30 Left 1125024198 15:35014038-35014060 CCACCCAGTTTATGGTATTTTAT 0: 10
1: 166
2: 843
3: 2459
4: 4917
Right 1125024209 15:35014091-35014113 ATTTCGATGCTGAAAGAGGGAGG No data
1125024205_1125024209 -2 Left 1125024205 15:35014070-35014092 CCAAACCAGCTAAGATGGGGAAT No data
Right 1125024209 15:35014091-35014113 ATTTCGATGCTGAAAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125024209 Original CRISPR ATTTCGATGCTGAAAGAGGG AGG Intergenic
No off target data available for this crispr