ID: 1125026533

View in Genome Browser
Species Human (GRCh38)
Location 15:35036012-35036034
Sequence CAATTTAAGAGAATTGTAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125026528_1125026533 21 Left 1125026528 15:35035968-35035990 CCAATCCACTTAATGGCAGGTAG No data
Right 1125026533 15:35036012-35036034 CAATTTAAGAGAATTGTAGCCGG No data
1125026529_1125026533 16 Left 1125026529 15:35035973-35035995 CCACTTAATGGCAGGTAGAGTGG No data
Right 1125026533 15:35036012-35036034 CAATTTAAGAGAATTGTAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125026533 Original CRISPR CAATTTAAGAGAATTGTAGC CGG Intergenic
No off target data available for this crispr