ID: 1125033584

View in Genome Browser
Species Human (GRCh38)
Location 15:35097498-35097520
Sequence CAGCATGTGCATTTGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125033584_1125033590 18 Left 1125033584 15:35097498-35097520 CCCTGTCCCAAATGCACATGCTG No data
Right 1125033590 15:35097539-35097561 CCTCAGAATGTGACTGTACTTGG 0: 10
1: 257
2: 741
3: 1567
4: 2406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125033584 Original CRISPR CAGCATGTGCATTTGGGACA GGG (reversed) Intergenic
No off target data available for this crispr