ID: 1125040954

View in Genome Browser
Species Human (GRCh38)
Location 15:35186812-35186834
Sequence AACTGGGGCCCCTTTTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125040950_1125040954 0 Left 1125040950 15:35186789-35186811 CCATGTTGGCAAGGATGTGGAGA No data
Right 1125040954 15:35186812-35186834 AACTGGGGCCCCTTTTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125040954 Original CRISPR AACTGGGGCCCCTTTTCCTT TGG Intergenic
No off target data available for this crispr