ID: 1125045019

View in Genome Browser
Species Human (GRCh38)
Location 15:35235230-35235252
Sequence GAACTGGACTTTCCTACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125045019_1125045022 -7 Left 1125045019 15:35235230-35235252 CCAGGGGTAGGAAAGTCCAGTTC 0: 1
1: 0
2: 1
3: 12
4: 124
Right 1125045022 15:35235246-35235268 CCAGTTCCCTTTCCTTGGTTTGG 0: 1
1: 0
2: 2
3: 20
4: 196
1125045019_1125045026 5 Left 1125045019 15:35235230-35235252 CCAGGGGTAGGAAAGTCCAGTTC 0: 1
1: 0
2: 1
3: 12
4: 124
Right 1125045026 15:35235258-35235280 CCTTGGTTTGGACAACCTTGTGG 0: 1
1: 0
2: 1
3: 8
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125045019 Original CRISPR GAACTGGACTTTCCTACCCC TGG (reversed) Intronic
901973193 1:12924544-12924566 TAACTGCACTTACCTACCACAGG + Intronic
902011984 1:13277219-13277241 TAACTGCACTTACCTACCACAGG - Intergenic
904251094 1:29224882-29224904 GAACTGGCCTTTCCCACCCTGGG - Intronic
905441558 1:37999528-37999550 GAACTGGCATTTCCTATGCCGGG - Intronic
908113631 1:60920648-60920670 GAACTAGGTTTTCCTTCCCCAGG - Intronic
909075728 1:71048070-71048092 GCACTGGACTTGCGGACCCCAGG + Intergenic
915553220 1:156646940-156646962 CAAGTGGACTTTCCTGTCCCGGG + Exonic
915824897 1:159065005-159065027 GAACATGACTTTCCTATCCAAGG + Intronic
916934992 1:169618476-169618498 GAAATGGCCTCTCCTGCCCCGGG - Intronic
917641943 1:176991189-176991211 GAACTTGAACTTCCTACCTCAGG - Intronic
918549283 1:185722186-185722208 GAACTTGACTTTATTAACCCAGG - Intergenic
920661948 1:207922826-207922848 GAACTGGACTGTCTAACCTCAGG + Intergenic
922944531 1:229501114-229501136 TAACTGGACTTTTCTAGCCCAGG - Intronic
924221851 1:241885317-241885339 GAACTGGACTTATATAGCCCAGG - Exonic
924299456 1:242622654-242622676 AATCTTGACTTTCCTGCCCCTGG + Intergenic
924553133 1:245097099-245097121 AAAATGGACTTCCCTACTCCCGG - Intronic
1066371581 10:34822218-34822240 GAAGAGGACTTTCCTGCTCCAGG - Intergenic
1067171459 10:43910383-43910405 GAAATGGAGTATCCTTCCCCCGG + Intergenic
1067553948 10:47254666-47254688 GAACAAGTCATTCCTACCCCAGG - Intergenic
1069904153 10:71722630-71722652 GTCCTGGCCTTCCCTACCCCTGG - Intronic
1071158011 10:82713431-82713453 GAACTTGACTCTCCTACCATTGG + Intronic
1072991626 10:100201185-100201207 GAACTTGGATTTCCCACCCCAGG + Intronic
1075658005 10:124174504-124174526 GTCCTGGCCTTTCCTAACCCTGG - Intergenic
1076562380 10:131375568-131375590 AAACTAGACCTTCCCACCCCAGG - Intergenic
1077175607 11:1188736-1188758 GATGTGGACTTTCCATCCCCTGG + Intronic
1077175837 11:1190035-1190057 GACGTGGACTTTCCATCCCCTGG + Intronic
1077972639 11:7211203-7211225 GCCCTGAACTTTCCTACCCCTGG + Intergenic
1080583216 11:33660126-33660148 GAAAAAGACTTTCCTTCCCCAGG + Intronic
1081732556 11:45381734-45381756 GAACAGGACTTTCCAATCCCTGG - Intergenic
1081855367 11:46300052-46300074 GAACTGGACTCCCCTACGCCAGG + Exonic
1083237424 11:61360636-61360658 GAACTAGCATTTCTTACCCCTGG - Intronic
1083935442 11:65867554-65867576 GGAGTGGACTTTCTGACCCCAGG + Intronic
1088456515 11:110038392-110038414 GCACTGCACTTTCCTTCCCTCGG - Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1093871817 12:24301761-24301783 AAAATGCATTTTCCTACCCCTGG + Intergenic
1095837613 12:46655582-46655604 GAACTTGAATTTCCTTCCTCGGG + Intergenic
1097385240 12:58943432-58943454 GACCTGGAGTCTGCTACCCCTGG + Intergenic
1099591756 12:84601240-84601262 CAACTAGACTTTCCTACACTAGG + Intergenic
1100371922 12:93976337-93976359 GAGATGGACTTTTCTACCTCTGG - Intergenic
1100408865 12:94295076-94295098 GAACAGGAATTTCCTGCCCCAGG - Intronic
1101641202 12:106586766-106586788 CCACTGGACATCCCTACCCCGGG - Intronic
1102578125 12:113870015-113870037 GTACTGGATTTAACTACCCCTGG + Intronic
1104473591 12:129051938-129051960 GTACTTGAGTTTCCTGCCCCAGG + Intergenic
1105509359 13:21038224-21038246 GCACTGGCCTCTCCTGCCCCCGG - Intronic
1107943441 13:45395471-45395493 GACCTGGACTGTTCAACCCCAGG - Exonic
1110064374 13:71085013-71085035 GAACTGCAAGTTCCTACCCTTGG - Intergenic
1110936483 13:81296489-81296511 AAACTGGGCTTTCCTACAGCTGG - Intergenic
1114549357 14:23524191-23524213 AAACTGGCCTTTCCTCTCCCGGG + Exonic
1119552590 14:75525722-75525744 GAAATGGGCCTTTCTACCCCAGG + Intronic
1119632687 14:76247380-76247402 GACCTGGACTTACCCAACCCAGG - Intronic
1122365479 14:101192594-101192616 GAAATGGCCTTTCCTTCTCCAGG - Intergenic
1122937901 14:104968320-104968342 GAACTGGACTATCCTGGCGCAGG + Intronic
1124167435 15:27340282-27340304 CAACTGCACTTTCTTTCCCCTGG - Intronic
1125045019 15:35235230-35235252 GAACTGGACTTTCCTACCCCTGG - Intronic
1126396981 15:48228806-48228828 TACCTAGACTTTCCTACTCCTGG + Intronic
1126612768 15:50546415-50546437 GAGCTTGACTTTCCCACCACTGG + Intronic
1126741549 15:51781577-51781599 GAACTGGATCCTCCTGCCCCAGG - Intronic
1128537758 15:68503540-68503562 GACCTGGATTTTCCTCCCTCTGG + Intergenic
1128720663 15:69945768-69945790 GAGGTGGACATTCCCACCCCTGG - Intergenic
1133034278 16:3026343-3026365 GACCTTGCCTTTCCTTCCCCAGG + Exonic
1136293407 16:29289139-29289161 GCACTGGTCTGTCCGACCCCGGG + Intergenic
1137031148 16:35526030-35526052 GAACAGGACCTCCCTACTCCAGG - Intergenic
1140114329 16:72028549-72028571 CAACTTGATTTTCCTACCCAGGG - Intergenic
1142099288 16:88263145-88263167 GCACTGGTCTGTCCAACCCCGGG + Intergenic
1142140606 16:88471108-88471130 GAGCTGGGCTTTCCTCCTCCCGG - Intronic
1142470902 17:162794-162816 GAACTGGAGTCTCCTTCCCAGGG + Intronic
1143884389 17:10055131-10055153 GATGTGCACTATCCTACCCCAGG - Intronic
1149850708 17:60032025-60032047 GAACTGGAGTCTCCTTCCCAGGG - Intergenic
1149859458 17:60114499-60114521 GAACTGGAGTCTCCTTCCCAGGG + Intergenic
1154134327 18:11762419-11762441 GAACAGCACTTTTCTACCTCTGG + Intronic
1159870139 18:73751887-73751909 GAACTGGATGTTACTTCCCCAGG + Intergenic
1164837471 19:31366594-31366616 GAACTTGACTCTCCCACACCTGG + Intergenic
1167235240 19:48310403-48310425 GAACTTGATTTTCCTACTCTAGG - Intronic
926222721 2:10946750-10946772 CAACTGGCCTTTCTTACCTCAGG + Intergenic
930277779 2:49333729-49333751 GAAATGGACTTTGATACCACAGG - Intergenic
936981445 2:118269030-118269052 GAACTGCACTTTGCTTCCTCGGG - Intergenic
939704345 2:145433565-145433587 CAACTTAACTTTCCTACTCCAGG - Intergenic
943807234 2:192137333-192137355 GCCCTGGACTTTTCTGCCCCAGG - Intronic
945168822 2:206974584-206974606 GAACTGGGCTTTCACACCCCTGG - Intergenic
1169550376 20:6695973-6695995 GAACTGGGCTCCCCAACCCCTGG - Intergenic
1171963837 20:31514887-31514909 GGGCTGGCATTTCCTACCCCGGG + Intronic
1172880480 20:38196486-38196508 GAACAGGACTGGCCTCCCCCAGG - Intergenic
1174553635 20:51378834-51378856 GACCTGGCCTGGCCTACCCCTGG - Intergenic
1174933992 20:54847374-54847396 GAACTGGATTTTGCTAAGCCTGG + Intergenic
1175278888 20:57789249-57789271 GATCTGGACATTCCCACCCTGGG + Intergenic
1177646168 21:23902274-23902296 GGACTGGACTTTCCTACTCTAGG - Intergenic
1177894948 21:26846334-26846356 GAACCCCACTTTCCTACCCGGGG + Intergenic
1178396796 21:32250068-32250090 GGACTCGACTTTCCTTCCCGTGG + Intergenic
1179551850 21:42148460-42148482 GACCTGGAGGTTCCTAACCCAGG + Intergenic
1179835350 21:44028334-44028356 GAACTGGGCTTTCCTCAGCCTGG + Intronic
1181384604 22:22534868-22534890 GAACTAGACATTCCTCTCCCTGG - Intergenic
1181519542 22:23437192-23437214 GAACAGGACATCCCTGCCCCAGG + Intergenic
1182076139 22:27496715-27496737 GAGCTGGGGTTACCTACCCCAGG - Intergenic
1184727558 22:46355670-46355692 CAACGGGACTTTCCTACCCCAGG - Intronic
1184781510 22:46651954-46651976 GGCGTGGACTTTCCTGCCCCTGG - Intronic
1185124557 22:49000665-49000687 GAAGTGGACTTTCCTATGGCAGG + Intergenic
949864178 3:8533490-8533512 GAACTTAACTTTCCTCTCCCAGG - Intronic
951930537 3:27962100-27962122 GAAATGGACTTTCTGAGCCCAGG + Intergenic
952222515 3:31339110-31339132 GAACTGCAGTTTCCTACCTGAGG + Intergenic
957196230 3:77071920-77071942 GAACAGGAGTCTCCAACCCCTGG + Intronic
960452699 3:117829886-117829908 GAAGTGGACTTTCCTCATCCTGG - Intergenic
968234374 3:197023059-197023081 TAACTGGTCTCTCCTGCCCCCGG + Exonic
971862704 4:32128588-32128610 GAACTGGACCTTCCTAAACTTGG + Intergenic
973041390 4:45474154-45474176 TATCTGGGCTTTCCTCCCCCTGG - Intergenic
973808039 4:54544515-54544537 GAAATGCACTTTCCTAACCTTGG + Intergenic
973850926 4:54960868-54960890 GAACAGCAGCTTCCTACCCCAGG - Intergenic
982412915 4:155099349-155099371 GAACTGGGCTTTCCCAACCTTGG + Intergenic
983676177 4:170295988-170296010 AAACTAGACTTTTCTACCACTGG - Intergenic
987015486 5:13814380-13814402 GAACTGGGATTTCCAACCTCTGG - Intronic
988323020 5:29724713-29724735 CAACTGTGCTTTCCTAACCCAGG + Intergenic
991146688 5:63314884-63314906 GAACTGAACATTCCAACCCCCGG + Intergenic
994816544 5:104593706-104593728 CACCTGGACTGTCCTCCCCCAGG + Intergenic
998416004 5:141946492-141946514 GAGCTGGCCCTTCCTCCCCCTGG + Intronic
1001663425 5:173413321-173413343 GAGCTGGGCTTTCATACCCCGGG + Intergenic
1005812976 6:29530450-29530472 GACCTGGCCTTTCCAACCTCGGG - Intergenic
1005913841 6:30334513-30334535 GAACTGGCAATTCCTACCCCAGG - Intronic
1006284995 6:33085909-33085931 GAGCGGGACTTACCTTCCCCTGG + Intronic
1006667190 6:35703833-35703855 GAACTTGACCTTACAACCCCTGG - Intronic
1011729990 6:90251918-90251940 GGATTGAACTTTCCCACCCCTGG - Intronic
1014479711 6:121920854-121920876 CACATGGCCTTTCCTACCCCAGG + Intergenic
1018497277 6:164361685-164361707 GAATTGAACTTTCCTACCATTGG - Intergenic
1019591719 7:1839086-1839108 GAACAGGACATCCCTGCCCCAGG - Intronic
1020188683 7:5977689-5977711 AAACTGGACCTTCGGACCCCAGG - Exonic
1032539374 7:132690658-132690680 GACCTGGACTTGCCTTACCCGGG - Intronic
1037666479 8:20974124-20974146 GAAATGCACTTTGCTGCCCCAGG - Intergenic
1038623429 8:29167297-29167319 GAGCTTGAATTTCCTTCCCCTGG - Intronic
1039952797 8:42185023-42185045 CTCCTGGACTTTCCTCCCCCAGG + Intronic
1045362496 8:101445877-101445899 GAACTGGACATTATAACCCCAGG - Intergenic
1047800757 8:128307263-128307285 AATCTGGACTTTCCAACCCTTGG - Intergenic
1048279357 8:133093759-133093781 GAAGTGGCCTTTCATACACCTGG - Intronic
1049711891 8:144068453-144068475 GAACTGGACTTGCCTCCCAAGGG - Intergenic
1049871216 8:144978831-144978853 GATCTTGCCTTTCCTACTCCAGG - Intergenic
1051141114 9:13979857-13979879 GCCTTGGACTTTCCCACCCCTGG + Intergenic
1052838224 9:33267263-33267285 TAAATGGGCTTTCCTACCTCTGG - Intronic
1186502912 X:10066380-10066402 GAACTGGAGGTTCCTGCCCCTGG - Intronic
1191985626 X:66977143-66977165 GTACTGGAATTTTCTACCCAGGG + Intergenic
1192573562 X:72225251-72225273 TACCTGGACTGTCCTCCCCCAGG + Intronic
1201625546 Y:16010995-16011017 GAACTGAACTTTCTTAGCCATGG - Intergenic