ID: 1125045019

View in Genome Browser
Species Human (GRCh38)
Location 15:35235230-35235252
Sequence GAACTGGACTTTCCTACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125045019_1125045022 -7 Left 1125045019 15:35235230-35235252 CCAGGGGTAGGAAAGTCCAGTTC 0: 1
1: 0
2: 1
3: 12
4: 124
Right 1125045022 15:35235246-35235268 CCAGTTCCCTTTCCTTGGTTTGG 0: 1
1: 0
2: 2
3: 20
4: 196
1125045019_1125045026 5 Left 1125045019 15:35235230-35235252 CCAGGGGTAGGAAAGTCCAGTTC 0: 1
1: 0
2: 1
3: 12
4: 124
Right 1125045026 15:35235258-35235280 CCTTGGTTTGGACAACCTTGTGG 0: 1
1: 0
2: 1
3: 8
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125045019 Original CRISPR GAACTGGACTTTCCTACCCC TGG (reversed) Intronic