ID: 1125046432

View in Genome Browser
Species Human (GRCh38)
Location 15:35246456-35246478
Sequence AGGGAGACACTAATGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 282}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125046432_1125046440 28 Left 1125046432 15:35246456-35246478 CCTTTCCCCATTAGTGTCTCCCT 0: 1
1: 0
2: 1
3: 23
4: 282
Right 1125046440 15:35246507-35246529 CCTGCCTTTTAGTGAGCAATGGG 0: 1
1: 0
2: 1
3: 9
4: 131
1125046432_1125046438 27 Left 1125046432 15:35246456-35246478 CCTTTCCCCATTAGTGTCTCCCT 0: 1
1: 0
2: 1
3: 23
4: 282
Right 1125046438 15:35246506-35246528 GCCTGCCTTTTAGTGAGCAATGG 0: 1
1: 1
2: 1
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125046432 Original CRISPR AGGGAGACACTAATGGGGAA AGG (reversed) Intronic
900545093 1:3224369-3224391 AGGGAGACACTACTGGGTATTGG - Intronic
901519061 1:9768910-9768932 AGGGAGAAAGTAAAGGAGAAAGG + Intronic
901782146 1:11601293-11601315 AGGGACACACTCATGGGAAGAGG + Intergenic
902577922 1:17389994-17390016 TGGGAAACACTAATAGGAAAAGG + Intronic
903862169 1:26371094-26371116 AGGGAGACAGTGATGGTGACAGG + Intronic
904045528 1:27606067-27606089 AGGCAGAATCTAATGGGTAATGG - Intergenic
904416127 1:30362077-30362099 AGGGAGACCCCAAGGGGGCAGGG - Intergenic
904590577 1:31613113-31613135 AGGGACACACAAGTGGGGGAAGG - Intergenic
905612142 1:39362902-39362924 AGGAAGATACAAATGTGGAAAGG - Intronic
905856243 1:41316674-41316696 AGGGAGTCACTGATGGGACAGGG - Intergenic
906180095 1:43810718-43810740 AGGGCGAAACTCCTGGGGAAAGG - Intronic
906188572 1:43880724-43880746 GGGAACACACTATTGGGGAATGG - Intronic
906238362 1:44225808-44225830 AGGGAGACCCTCAGGAGGAAGGG + Intronic
906318983 1:44805198-44805220 AGGCATACACTAATGGGGAGGGG + Intronic
906502616 1:46352537-46352559 AAGGCGAAAGTAATGGGGAAAGG + Intronic
907381192 1:54091711-54091733 AGGGAGAAAGTAAAGGGGAATGG - Intronic
907907702 1:58799494-58799516 ATGGAGACACTACTGGGACAGGG + Intergenic
909834494 1:80236728-80236750 CTGGAGACTCTACTGGGGAAGGG - Intergenic
913466681 1:119150103-119150125 AGGGGGAAGTTAATGGGGAAAGG - Intergenic
913616744 1:120567625-120567647 TGGGAGACAGTAATGTTGAACGG + Intergenic
913655330 1:120954801-120954823 AGGGAGGGACCAGTGGGGAAGGG - Intergenic
914573531 1:148943285-148943307 TGGGAGACAGTAATGTTGAACGG - Intronic
915171881 1:153983694-153983716 AAGGAAACAGTAAAGGGGAACGG + Intronic
916769522 1:167894560-167894582 AGGGAGACAGAAATGGCAAAGGG + Intronic
917141317 1:171838834-171838856 AGGGAGATATAACTGGGGAAGGG - Intergenic
918876179 1:190046416-190046438 AGGGAGGCAGAAATGGGGGAGGG + Intergenic
920207053 1:204299846-204299868 AGGGAGACACCCATTAGGAAGGG - Intronic
921871529 1:220145947-220145969 AGGGGGACACAAAAGAGGAATGG - Intronic
922210547 1:223483359-223483381 AGGGAAAGCCTAATGGTGAATGG + Intergenic
923054870 1:230418446-230418468 AGGGAGGTACTGATGGGAAAGGG + Intronic
923555835 1:234999784-234999806 AGGTAGACACCCATGGGGAGAGG - Intergenic
923562438 1:235051352-235051374 TGGGAGACTCTTCTGGGGAAAGG + Intergenic
924129785 1:240895085-240895107 AGGGAGAGAGTGAGGGGGAAGGG - Intronic
924814853 1:247432613-247432635 AGGCAGACACAAACAGGGAAGGG + Intronic
1063053997 10:2483761-2483783 AAGGAGACACGAATAGGTAAAGG + Intergenic
1063835772 10:10010015-10010037 ATAGAGACAATAATGGGGAGAGG + Intergenic
1064754187 10:18559828-18559850 ATGGAGAAAGGAATGGGGAATGG + Intronic
1067675370 10:48370621-48370643 AGGGTAACACTAAAGGGGAATGG + Intronic
1069342909 10:67433236-67433258 AGAGAGACACAGATGGGGAAAGG + Intronic
1071234585 10:83630502-83630524 AGTCAGAAACTGATGGGGAAGGG - Intergenic
1071712323 10:88061602-88061624 AGTGGGACACCAATAGGGAAGGG + Intergenic
1071901470 10:90124813-90124835 ATGCAGACACTGGTGGGGAAAGG - Intergenic
1072782805 10:98261766-98261788 AGGGAGACAGCATTGGGTAAGGG - Intronic
1073906543 10:108287317-108287339 ATGGATTCACTAGTGGGGAAGGG + Intergenic
1074645963 10:115452835-115452857 AGGGAGAAAGAAAAGGGGAAGGG - Intronic
1075842300 10:125515508-125515530 AAGGAGACAATCAAGGGGAAAGG - Intergenic
1076013310 10:127007432-127007454 AGAGAGACCCTTCTGGGGAAAGG + Intronic
1078391986 11:10943110-10943132 AGGGAGAGAGAAATGGGCAAAGG - Intergenic
1078737205 11:14031204-14031226 AGGAAGAGATTAATGGGGAAAGG + Intronic
1079143369 11:17829355-17829377 AGGGAGACGCTAATTAGAAATGG - Intronic
1081165305 11:39801398-39801420 AGGTAAACACAAATGTGGAATGG + Intergenic
1081580225 11:44346851-44346873 AGGGAGGCACTGATGTGTAAAGG - Intergenic
1081874189 11:46397568-46397590 AGGGAAACAGGAATGGGGACAGG + Exonic
1082822285 11:57552251-57552273 AGGGAAAAATGAATGGGGAATGG + Exonic
1083090587 11:60195322-60195344 AGGAATATACTAATGGAGAAAGG - Intergenic
1083784879 11:64938630-64938652 AGTGAAGCACTAATGGGAAATGG - Intronic
1083788361 11:64967539-64967561 AGTGAGGCACAAATGGAGAATGG + Intronic
1086731986 11:90262252-90262274 AGTGAAACATTATTGGGGAAAGG - Intergenic
1087202943 11:95364410-95364432 AGGGAGAACCTACTGGGGGAAGG + Intergenic
1088122065 11:106381558-106381580 AGTGATAGACTAATGGGGAGAGG - Intergenic
1088927729 11:114319437-114319459 ATGGAGACTCTAAGGGGGCAAGG + Intergenic
1088990944 11:114952921-114952943 AAGGAGACAGTAAGGAGGAAAGG + Intergenic
1088991978 11:114961521-114961543 AGAGAGAAACAACTGGGGAAGGG - Intergenic
1089049123 11:115530838-115530860 AGGGAGACAGTCAATGGGAAGGG - Intergenic
1089892222 11:121892988-121893010 AAGGAGACAATAAAGGGAAAGGG - Intergenic
1091836338 12:3588745-3588767 AGAGAGACTGTGATGGGGAAGGG + Intronic
1092364484 12:7865623-7865645 AAGGAGAGAGAAATGGGGAATGG - Intronic
1093167228 12:15818024-15818046 ATGGAGAAACTCATGTGGAAAGG - Intronic
1097191291 12:57220773-57220795 AGGGAGACTGGAATGGGAAATGG - Intronic
1098862343 12:75724197-75724219 ATGGAAACACATATGGGGAAAGG - Intergenic
1100355754 12:93827886-93827908 AGGGAACCACTACTGGGGGAAGG - Intronic
1101681051 12:106965734-106965756 ATGGATACTCCAATGGGGAAAGG - Intronic
1101859324 12:108469766-108469788 AAGGAGTCACAAATGTGGAAAGG + Intergenic
1102476843 12:113194298-113194320 AAGGTGACACTAAAGGGCAACGG + Intergenic
1102821772 12:115914759-115914781 TGGGATGCACTTATGGGGAAGGG + Intergenic
1103196269 12:119046091-119046113 AGCGACCCACTGATGGGGAAAGG + Intronic
1104722669 12:131053976-131053998 AGGGAGACAGTAAATGGGACGGG - Intronic
1107405738 13:40111047-40111069 AGGTAGACAATAAGGGAGAAAGG + Intergenic
1107459103 13:40584074-40584096 AGGGGGAGACAGATGGGGAATGG + Intronic
1107502944 13:40999336-40999358 TTGGAGAGACTAAAGGGGAAAGG + Intronic
1109863376 13:68229041-68229063 AGGCAGACAGTAATGGAGCAGGG + Intergenic
1111983555 13:95042075-95042097 ATGGAGACACTAATGGAGTTGGG + Intronic
1112205855 13:97322719-97322741 ATGGAGACAGGAATAGGGAAGGG - Intronic
1114968109 14:27990322-27990344 AGGAAGACAGTAATGAGGTAAGG - Intergenic
1115368768 14:32588424-32588446 AGGCAGACACAAATGGGACAAGG - Intronic
1115519775 14:34221673-34221695 AGGGAGGAATTAATGAGGAAGGG + Intronic
1116369157 14:44108259-44108281 AGAGAGAGACAAATGGGGAGGGG - Intergenic
1117116086 14:52514029-52514051 AAGGAGAGACTAATGGAAAAAGG + Intronic
1118168838 14:63364930-63364952 AGGGAGTTACTAATAAGGAAAGG + Intergenic
1119425710 14:74533560-74533582 AGGAAGGCACTGAAGGGGAAGGG + Intronic
1120079310 14:80197748-80197770 AGGGAGACAAAGATGGGGAGAGG + Intronic
1120801155 14:88690163-88690185 GGGGAGACAGTAATGGGAAATGG + Intronic
1121168266 14:91830546-91830568 AGGAAGAGGCAAATGGGGAATGG + Intronic
1121677883 14:95769219-95769241 AGGGAGAAAGAAATAGGGAATGG + Intergenic
1125046432 15:35246456-35246478 AGGGAGACACTAATGGGGAAAGG - Intronic
1126209991 15:46091151-46091173 AGGGAGCCATAAAAGGGGAATGG - Intergenic
1127599016 15:60516558-60516580 AGGGCGACACTAGTGGGGAGAGG + Intronic
1129507833 15:76098203-76098225 GGGGAGAAACTAGTGGGAAAAGG - Intronic
1129820778 15:78600399-78600421 AGGGAGACACTGACTGGCAAGGG + Intronic
1131277650 15:90995021-90995043 AGCCATACACTAAAGGGGAAGGG + Intronic
1132228964 15:100167755-100167777 AGGGAGATAATTATGGGAAAAGG + Intronic
1132422873 15:101689074-101689096 AGGGAGCCCATAATGGGCAATGG - Intronic
1133444222 16:5846345-5846367 TGGGAAAGAATAATGGGGAAAGG + Intergenic
1134507981 16:14823508-14823530 AGGGACACACAAATGGGAAGTGG + Intronic
1134695683 16:16222271-16222293 AGGGACACACAAATGGGAAGTGG + Intronic
1134818601 16:17227284-17227306 AGGCAGACACACTTGGGGAAGGG + Intronic
1134976145 16:18572415-18572437 AGGGACACACAAATGGGAAGTGG - Intergenic
1135936905 16:26788379-26788401 AGGTAGACTCAAATGTGGAATGG - Intergenic
1136621713 16:31433826-31433848 TGGGAGACAGAAAAGGGGAAAGG + Intronic
1139898594 16:70308972-70308994 AAGAATACACTAATGGGGGAGGG - Intronic
1140809017 16:78559093-78559115 AGAGGGACAGTAGTGGGGAAGGG + Intronic
1142096544 16:88242986-88243008 AGGGAGACACTGATGCGGTGGGG + Intergenic
1143635499 17:8162105-8162127 AGGGAGACAGGGATGGGGCATGG + Intronic
1143645001 17:8224227-8224249 AGGGAGACAGGAATTGGAAAAGG - Intergenic
1144522012 17:15959147-15959169 AGGGAGACTTTGATGGGGAATGG + Intronic
1146134797 17:30309937-30309959 AGGGAGGGGCAAATGGGGAAAGG - Intergenic
1147915883 17:43885567-43885589 AGGGAGACACAAATATGGAATGG - Intronic
1149587814 17:57804628-57804650 AGGGAGAGATATATGGGGAATGG - Intergenic
1149768522 17:59300869-59300891 AGGGAGACAGGGAGGGGGAAGGG - Intergenic
1151327160 17:73386414-73386436 AGAGAGAGACTGCTGGGGAAGGG + Intronic
1155267274 18:24106208-24106230 GGGGAGACACTAATTGGCACTGG - Intronic
1155700469 18:28736882-28736904 CTGGAGACACTAATATGGAAAGG + Intergenic
1156266208 18:35490592-35490614 AAGGACACACTAAAGGGAAAGGG + Intronic
1158273128 18:55738096-55738118 AGGGAGAAAATAAAGGAGAAAGG - Intergenic
1159864170 18:73685037-73685059 ATTGAGACACTAAGGGGGAAAGG + Intergenic
1161218519 19:3106848-3106870 ATGGATACACTGATGGGGGAGGG - Intronic
1161533227 19:4802927-4802949 AGCGAGACACTCTTGGGGGAGGG + Intergenic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1162979039 19:14226657-14226679 AGGGAGACAGTAAGGGGGGGTGG + Intergenic
1165137394 19:33678217-33678239 AGGCAGAGACTAATGGAGAAGGG + Intronic
1166348065 19:42179184-42179206 AGGGAAGCACCAAGGGGGAAAGG + Intronic
1167396567 19:49233261-49233283 AGGGAGACGCTGAAGGAGAAGGG - Intergenic
1168296147 19:55378136-55378158 AGGGAGGCACCGAGGGGGAAGGG + Exonic
925287480 2:2725388-2725410 AGGGAGACGCTGATGTGGAAGGG - Intergenic
925569268 2:5291702-5291724 AAGGAGATAATAATGGGAAAAGG - Intergenic
926738866 2:16094723-16094745 AGGGAGACACTGGTGGGGAAGGG - Intergenic
927565179 2:24105311-24105333 AGGGAGACAGTAATTGGAAGGGG + Intronic
927619040 2:24632585-24632607 TGGGAGCCAATAATGGAGAAGGG - Intronic
932774809 2:74521800-74521822 AGGGAGAGACGCATGGGGAGAGG - Intronic
934079851 2:88458572-88458594 AGGGAGACTCACAAGGGGAAGGG - Intergenic
934914324 2:98287522-98287544 AGGGAGAGATGAATGGGGATTGG + Intronic
935712793 2:105913965-105913987 AGGGAGAGGCCAATGAGGAAAGG + Intergenic
937145972 2:119644834-119644856 AGGGAGATACAAATATGGAATGG - Intronic
937327158 2:120996916-120996938 AGTGAGCAACTAACGGGGAAGGG + Intergenic
939244050 2:139599876-139599898 AGGGAGACACTTCTGAAGAATGG - Intergenic
939436074 2:142179864-142179886 AGGGAAACAATAATGTGGTAGGG + Intergenic
939893501 2:147765044-147765066 AAGGAGACAAAAAAGGGGAAAGG - Intergenic
942791463 2:179765959-179765981 AGGGAGACACTGCTGGGAAAAGG + Intronic
944001326 2:194842312-194842334 AGAGAGAAACTGATGGGGATAGG + Intergenic
944493453 2:200282467-200282489 AAGGAGACTCCAATGGGGGATGG + Intergenic
945061713 2:205915021-205915043 AGGGAGACATTAATTGGGGCTGG - Intergenic
945346110 2:208718704-208718726 AGAGAGAGAGCAATGGGGAATGG + Intronic
946302251 2:218831177-218831199 AGGGAAACACACCTGGGGAAAGG + Intronic
946755750 2:222945743-222945765 ATAAAGACACTAATGGGGAAGGG - Intergenic
946829245 2:223711269-223711291 AGGTAGATACTATTGGGGATGGG + Intergenic
947115714 2:226768132-226768154 AGGGAGAGACTTATGGGGCGAGG - Intronic
1169354028 20:4892879-4892901 AGAGAGGGAATAATGGGGAAAGG + Intronic
1170105460 20:12750545-12750567 AGGGAGACTGGAAAGGGGAAGGG - Intergenic
1170485215 20:16808563-16808585 TGAGAGACACTGATGGGGAGGGG + Intergenic
1171072905 20:22092525-22092547 GGGGAGCCAGAAATGGGGAATGG + Intergenic
1172427688 20:34866497-34866519 AGGGAGATAGGAATGGGAAAGGG + Intronic
1173706482 20:45114185-45114207 AAGGGGACAGTAATGGGGACAGG - Intronic
1174174803 20:48637764-48637786 AGGGAGACAGAAAGGGGGACGGG + Intronic
1174931705 20:54823178-54823200 AGGAATGCACTCATGGGGAATGG - Intergenic
1175389228 20:58615862-58615884 AGGGAGAGAGAAAGGGGGAAAGG + Intergenic
1175729465 20:61344121-61344143 AGGGAAGCACTAATGAGGACTGG + Intronic
1176292127 21:5052006-5052028 AGGGACACATGAATGTGGAATGG - Intergenic
1178561288 21:33642040-33642062 AAGGAGAGAATAATGTGGAAAGG - Intronic
1179375980 21:40850128-40850150 AGGAAGACAGAACTGGGGAAGGG - Intergenic
1179652262 21:42819092-42819114 AGGGAGTCACAAATCTGGAAAGG + Intergenic
1179865130 21:44211644-44211666 AGGGACACATGAATGTGGAATGG + Intergenic
1180224854 21:46386285-46386307 ACGCAGACACTAAAGGGGAGGGG - Intronic
1181407485 22:22695109-22695131 AGAGTGACACGTATGGGGAAGGG - Intergenic
1181427074 22:22850695-22850717 AGGGTGACACAGATTGGGAAGGG - Intronic
1181497366 22:23295123-23295145 ACGGACAGACTCATGGGGAAGGG + Exonic
1182451104 22:30422427-30422449 AGGGAGACACTGAGGGGGCCAGG - Exonic
1185298672 22:50067610-50067632 ATGGAGTCACTGATGGGGGATGG - Intronic
951490115 3:23260805-23260827 AGGGAGACAGTAATGGGGCTGGG + Intronic
955041468 3:55321473-55321495 ATGGAAACACTAAGGGTGAAAGG + Intergenic
956056783 3:65307445-65307467 AGGTATACAGTATTGGGGAACGG + Intergenic
956460677 3:69468557-69468579 AAAGGGACACTACTGGGGAAGGG + Intronic
956741360 3:72278801-72278823 AGGGAGACACCAAAGGGAAGGGG + Intergenic
959324408 3:104918742-104918764 AGGGAAAGACTAAGGGAGAAAGG + Intergenic
959651615 3:108756340-108756362 AGGGAAACAAGAATGGGCAAGGG + Intronic
959653786 3:108778229-108778251 AGAGGGAAACTGATGGGGAATGG + Intergenic
959687052 3:109158918-109158940 GGGAAGACACTAATGGAGTAAGG + Intergenic
960010200 3:112825552-112825574 AGGGAGACACAAATGAGTTAAGG + Intronic
962474175 3:135741178-135741200 AGGGAGGCAGTACTGGGGTATGG - Intergenic
962710622 3:138082704-138082726 AAGGAGACAGCAGTGGGGAATGG - Intronic
964549143 3:157867547-157867569 AGATAGACACTAATGTTGAATGG + Intergenic
967076151 3:186004367-186004389 AGGGAGACACTGAGAGGTAAAGG + Intergenic
967099394 3:186203788-186203810 ATGGAAACACGCATGGGGAAGGG - Intronic
967608817 3:191480942-191480964 AAGGAGACACTAAAGAGGATAGG + Intergenic
967642809 3:191886852-191886874 AGGATGACAATAGTGGGGAATGG - Intergenic
967677346 3:192316404-192316426 ATGCAGCCACTAATGGGGGATGG - Intronic
968966019 4:3769512-3769534 AGGGGGACGGGAATGGGGAATGG - Intergenic
969090434 4:4690046-4690068 GGGAAGACTCTAAGGGGGAAGGG - Intergenic
969120031 4:4901553-4901575 AGGGAGTCATGAATGGGGAAAGG - Intergenic
969306474 4:6328812-6328834 AGGGAGACAGTAGTGGTGATGGG + Intronic
969882957 4:10190506-10190528 GGGAAGACAATGATGGGGAAAGG + Intergenic
971035100 4:22684500-22684522 AGGAGGTCATTAATGGGGAAAGG - Intergenic
972003641 4:34070572-34070594 AGGGAGTTACAAATGTGGAAAGG + Intergenic
973265816 4:48209078-48209100 AGGGAGGCATTGATGGGGAGTGG - Intronic
973713299 4:53650486-53650508 AGGGAGTTACAAATGTGGAAAGG + Intronic
980267195 4:130532397-130532419 AGCTTGACACTAATGGGGAATGG + Intergenic
981672223 4:147300072-147300094 AGGGAGACAGGAGTGCGGAAGGG + Intergenic
982642762 4:157983830-157983852 GGGGAGACCAGAATGGGGAAAGG - Intergenic
984449352 4:179879107-179879129 AGGCAGACAGTGATGGGGAAGGG + Intergenic
984553564 4:181187909-181187931 AAGGACACTCTGATGGGGAAAGG + Intergenic
985025242 4:185733622-185733644 AGGTAGACACTACATGGGAAGGG + Intronic
985923262 5:2996084-2996106 AGCGTGACACTATTGGGGAAAGG - Intergenic
986816144 5:11414084-11414106 AGAGAGACAAAAATGGAGAAGGG + Intronic
987391357 5:17378523-17378545 ATGAAGACACTAGTGGGAAATGG + Intergenic
988961823 5:36378541-36378563 AGGGAGACACATATGAGGGAGGG - Intergenic
989122859 5:38021601-38021623 AGGGAGAAACAAAGGGTGAATGG - Intergenic
990106694 5:52272437-52272459 AGAGAGAGAAGAATGGGGAAAGG + Intergenic
991294874 5:65070275-65070297 AGGGAAAGACCAACGGGGAAGGG - Intergenic
991512445 5:67394585-67394607 AGAGACACACCAATGGGGAGTGG - Intergenic
992003055 5:72453720-72453742 AGGGTGACACTGATGGGAGATGG + Intronic
992782317 5:80139470-80139492 AGAAAGAAACAAATGGGGAAGGG - Exonic
992872454 5:81020788-81020810 AGAGATACACTAATAGAGAAGGG + Intronic
995829808 5:116343394-116343416 AGGTAAACCCTACTGGGGAAGGG - Intronic
998509014 5:142695985-142696007 AGGGAGACAGAACTGGGCAAGGG + Intronic
998754318 5:145359355-145359377 AGGGAGAGATTAATGGAGGATGG - Intergenic
999233078 5:150073720-150073742 ATGGAGGCACAAATGGGGATAGG - Intronic
999328939 5:150659969-150659991 AGGCACACACTCCTGGGGAAGGG - Intergenic
999676491 5:154008885-154008907 AGGGAGATACAAATGTGTAATGG + Intronic
1000425812 5:161090128-161090150 AGTGAGACAATAATGAGGAGCGG - Intergenic
1000549323 5:162640014-162640036 AGGGTGATACGAATGGGTAATGG - Intergenic
1001277870 5:170363858-170363880 GGGTAGACAGAAATGGGGAAGGG - Intronic
1002459131 5:179364294-179364316 AGGGAGACACGGAGGGGGAGAGG + Intergenic
1002882952 6:1268901-1268923 AGAGGGAAAGTAATGGGGAAAGG + Intergenic
1003285824 6:4733096-4733118 AGGGAGACACTCATGTGTATAGG - Intronic
1003348580 6:5294541-5294563 AGGGGGACAGTCATGGGGACTGG - Intronic
1003728207 6:8790611-8790633 AGACACATACTAATGGGGAAAGG + Intergenic
1003806980 6:9736692-9736714 AGGGTGTCACTCATCGGGAATGG - Intronic
1006570025 6:34994832-34994854 AGTGAGACACTCCTGGGGAGGGG + Intronic
1006941047 6:37752620-37752642 AGGGAGGCAGTAGTGGGGAGGGG - Intergenic
1007757745 6:44111361-44111383 TGGGGAATACTAATGGGGAAAGG - Intergenic
1007943538 6:45804467-45804489 TAGGAGACACTAATGGGGTGTGG - Intergenic
1010700090 6:79033935-79033957 AAGGAGAGAAAAATGGGGAAGGG + Intronic
1011308188 6:85952511-85952533 CGGGAGACACAGAAGGGGAAGGG - Intergenic
1012540797 6:100359443-100359465 AGAGAAACAACAATGGGGAAAGG + Intergenic
1013461115 6:110376418-110376440 AGGAAGACAGGAATGGGGGAAGG + Intergenic
1013890951 6:115026646-115026668 AGGTAGAAAGTAATGGGGATTGG + Intergenic
1016248076 6:142011233-142011255 AGGGAGATACTGATGTGGAAAGG + Intergenic
1017628402 6:156371329-156371351 TGGCAGACACTAATGGCTAAAGG + Intergenic
1017777739 6:157692548-157692570 TGGGAGACATGAATGGGGCAAGG - Intergenic
1018104875 6:160475867-160475889 AGAGAACCACTACTGGGGAAAGG - Intergenic
1018112996 6:160554676-160554698 AGAGAACCACTACTGGGGAAAGG - Intronic
1018373198 6:163187078-163187100 TGGGAGCCACTGATAGGGAAGGG - Intronic
1018473077 6:164113549-164113571 AGGGAGGCATTGATGGGGACTGG - Intergenic
1018674317 6:166205903-166205925 AGTTAGACACTAATGGGGTTTGG - Intergenic
1019885636 7:3902285-3902307 AGGGAGACACAAACATGGAATGG - Intronic
1019956727 7:4420906-4420928 AGAGAGAGAGTACTGGGGAAAGG - Intergenic
1020268520 7:6577743-6577765 CGGGAGGCCCTAATGGGGAGTGG + Intronic
1020342634 7:7128883-7128905 AGAGAGATACTTCTGGGGAAAGG + Intergenic
1020794469 7:12663543-12663565 AGAGAGACAGTCATGGGGATGGG - Intergenic
1022144706 7:27525358-27525380 ATGTTCACACTAATGGGGAAAGG - Intergenic
1022736891 7:33084519-33084541 TGGATGACTCTAATGGGGAATGG + Intergenic
1023221327 7:37922094-37922116 AGGAACACACTTAGGGGGAACGG - Intronic
1023577856 7:41648490-41648512 AGGGAGAGACGAATATGGAAAGG - Intergenic
1025935474 7:66032421-66032443 AGGCAGATAATAATGGGGAGAGG - Intergenic
1025948859 7:66127454-66127476 AGGCAGATAGTAATGGGGAGAGG + Intronic
1026427517 7:70311364-70311386 TGGGAGACAAGAATGGAGAAAGG - Intronic
1027122459 7:75531708-75531730 GGGGAGACACAGATTGGGAAAGG - Intergenic
1029460374 7:100690906-100690928 AGGGGCACACAAAGGGGGAATGG + Intergenic
1030151610 7:106411854-106411876 ATGGAGGCACTAATGGGCAGCGG + Intergenic
1030217791 7:107063774-107063796 TGGGAGAAACAAATGGGAAAAGG - Intronic
1032720332 7:134546393-134546415 AGGCAGAGAATAAAGGGGAAGGG - Intergenic
1035845653 8:2861603-2861625 AGGGAGACACATGTGGGCAAAGG - Intergenic
1039764962 8:40618893-40618915 CAGGAAACACTAATGGGGAGTGG + Intronic
1041193664 8:55378694-55378716 AGAGAGACAGAAATGGAGAATGG + Intronic
1044280248 8:90346332-90346354 AGGGAGGAATGAATGGGGAAAGG - Intergenic
1045141259 8:99286040-99286062 AGGGAGTAATTAATTGGGAAGGG - Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047461247 8:125067382-125067404 GGGGATACAGTGATGGGGAAAGG - Intronic
1047827256 8:128590592-128590614 AGGGAGAGAGAAAGGGGGAAAGG + Intergenic
1048054124 8:130847163-130847185 AGGGAGAAAGAAATGAGGAAGGG + Intronic
1048812809 8:138304057-138304079 AGTGAGACCCAGATGGGGAATGG + Intronic
1051487776 9:17626929-17626951 AGGGAACCAGTAATGGGGGAGGG - Intronic
1051846493 9:21457041-21457063 AGGGAAAGACTAATCAGGAAAGG + Intergenic
1055592813 9:77835406-77835428 AGGGAGAGGCTAGTGAGGAAAGG + Intronic
1055983573 9:82032106-82032128 AGGGAGACGATAAGGGAGAATGG + Intergenic
1056429693 9:86514943-86514965 AGGGGGTCACTGATGGAGAAAGG - Intergenic
1056563395 9:87752349-87752371 AGGCAGCAACTAATGGGGGAGGG + Intergenic
1057219551 9:93248600-93248622 AGGGAGATACTACGGGGGATGGG - Intronic
1059217723 9:112581677-112581699 AGTCATACACTAAAGGGGAAGGG + Intronic
1059929988 9:119250912-119250934 TGGGAGAGACGAATGAGGAAAGG + Intronic
1059964572 9:119601069-119601091 AGGGATACATTAATGGGGACAGG - Intergenic
1061651412 9:132053330-132053352 AGGGAAAAAATAATGGGGTACGG + Intronic
1062131006 9:134893089-134893111 ATGGAAACACTGCTGGGGAATGG + Intergenic
1062661913 9:137641020-137641042 TGGAAGACACTGATGAGGAACGG - Intronic
1185681355 X:1891077-1891099 AGGAAGACTCTAAGCGGGAAGGG + Intergenic
1186156677 X:6733212-6733234 AGGGAGACGGTATGGGGGAAAGG + Intergenic
1186256015 X:7720688-7720710 AGAGAGACAGAGATGGGGAATGG + Intergenic
1186865334 X:13715001-13715023 ATGGAATCACTAATGAGGAAAGG + Intronic
1190252934 X:48740871-48740893 AGTGAGACTCGAAAGGGGAAAGG + Intergenic
1190702956 X:53001678-53001700 AGGGAGAAAAAGATGGGGAAGGG - Intergenic
1192173925 X:68874328-68874350 AGGGAGACCATAACAGGGAAAGG + Intergenic
1193080868 X:77404767-77404789 AGGGAGACACTGCTGGGGCCAGG - Intergenic
1194767447 X:97858195-97858217 AGGGAGAGTCTAGTGAGGAAAGG + Intergenic
1195315034 X:103669026-103669048 AGGGAAAGAGTAAGGGGGAAAGG - Intergenic
1197367450 X:125581461-125581483 AGAGAGACGCAAATGGGGAAAGG + Intergenic
1197998916 X:132411659-132411681 AGGGAGAGATAAATGGGGACAGG - Intronic
1199649463 X:149938831-149938853 TGGGAGAAACCAATGGGGAGGGG + Intergenic
1201320005 Y:12688053-12688075 AGGAAGACTCAAACGGGGAAGGG - Intergenic