ID: 1125050635

View in Genome Browser
Species Human (GRCh38)
Location 15:35294500-35294522
Sequence CTGTTGAAGTTGAAGTTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125050635_1125050636 -10 Left 1125050635 15:35294500-35294522 CCTTGCAACTTCAACTTCAACAG 0: 1
1: 0
2: 2
3: 30
4: 213
Right 1125050636 15:35294513-35294535 ACTTCAACAGTACCTCCTGTTGG 0: 1
1: 0
2: 0
3: 16
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125050635 Original CRISPR CTGTTGAAGTTGAAGTTGCA AGG (reversed) Intronic
901051416 1:6427570-6427592 CTGTGGAGGTGGAAGTTGCTGGG - Intronic
902300982 1:15502581-15502603 CTGGGGAAGGTGAAGTGGCAGGG + Intronic
904380879 1:30109981-30110003 CTGATGTAGTTGAATTTGGATGG + Intergenic
905692311 1:39952618-39952640 CTGGTGGAGTTGAAGTTGCAAGG + Intergenic
907024671 1:51104580-51104602 CTGTGGAAATAGAAGTTGTATGG + Intronic
910055633 1:83030489-83030511 CTGTTTAAGTTGAACTTCTAAGG + Intergenic
910456834 1:87406653-87406675 CTGTTGAATTTGAATCTCCAGGG + Intergenic
910776480 1:90881497-90881519 CTGCTCAAGTTGCAGTTTCATGG + Intergenic
911289338 1:96037976-96037998 CTCCTGAAGCTGAAGTTCCATGG - Intergenic
911524678 1:98969974-98969996 ATGATGAATTTGAAATTGCAAGG - Intronic
911679266 1:100695479-100695501 CTGTCTAAGTGGAAGATGCATGG + Intergenic
912074778 1:105860194-105860216 TTGTTTAAGTTAAAGTTACATGG - Intergenic
912932806 1:113979922-113979944 CTGTTGAAGTTGGAGGTTCCCGG + Intronic
913703195 1:121394606-121394628 CTTTTGAATTTCTAGTTGCATGG - Intergenic
913939701 1:125089327-125089349 CTTTTGAATTTCTAGTTGCATGG + Intergenic
916920200 1:169458382-169458404 ATGTTGAAGTTAAAATTCCATGG - Intronic
917154956 1:171986549-171986571 CTCTTGAAGATGAAATGGCAAGG - Intronic
917354189 1:174108895-174108917 CTATTGAAGTTGAAATTCAATGG + Intergenic
920720772 1:208384768-208384790 CTGTGAAAGTTGAGGCTGCAGGG + Intergenic
921740948 1:218683913-218683935 TTGTTGAAGTTTAAATTTCACGG - Intergenic
922224015 1:223629564-223629586 CTTTTGAAGTTGACACTGCAAGG - Intronic
924120259 1:240790154-240790176 CTGGGGAGGTGGAAGTTGCAGGG + Intronic
1064896252 10:20240573-20240595 CTGTTAAATCTGAAGCTGCAGGG - Intronic
1066744913 10:38598931-38598953 CTTTTGAATTTCTAGTTGCATGG - Intergenic
1066956176 10:42175738-42175760 CTATTGAATTTGTAGTTGCATGG - Intergenic
1069183082 10:65387396-65387418 CTGTTGAAATTTAACATGCATGG - Intergenic
1070432391 10:76354017-76354039 GAGCTGGAGTTGAAGTTGCAAGG + Intronic
1071375892 10:85002845-85002867 CTGATGAAGTTCAAGTGTCAAGG + Intergenic
1071851720 10:89579197-89579219 CTTTTGAAGTTGACTTTGCAAGG + Intergenic
1074497324 10:113991512-113991534 CTCTGGAAATTCAAGTTGCATGG - Intergenic
1075847023 10:125552978-125553000 TTGTTGACTTTGAAGATGCAGGG + Intergenic
1079196576 11:18332893-18332915 AAGTTGAAGATAAAGTTGCACGG - Intronic
1079778998 11:24574535-24574557 CTGTTCAAGTTTAACATGCAAGG + Intronic
1081479001 11:43466410-43466432 CTGTTGATGGTGATGTTGAAGGG - Intronic
1082184270 11:49160961-49160983 CTCTTGATTTTGAATTTGCACGG + Intronic
1086682076 11:89684418-89684440 CTCTTGATTTTGAATTTGCATGG - Intergenic
1088372406 11:109106322-109106344 CTGCTCCAGTTGAAGTAGCAGGG + Intergenic
1089029823 11:115314084-115314106 TTGTTGACCTTGAAGATGCATGG - Intronic
1089560668 11:119341591-119341613 CTGTTGCAGTTGAAGGGCCAGGG + Exonic
1091631646 12:2165661-2165683 CTGTTTAAGTGGAAAATGCATGG + Intronic
1092026936 12:5248685-5248707 CTGTTGCAGTTGAAATTGCATGG - Intergenic
1094295153 12:28897512-28897534 CAGTTGAAGTGGAAGGTGAAAGG - Intergenic
1094764403 12:33575597-33575619 GTGTTAAAGAGGAAGTTGCAAGG + Intergenic
1097339149 12:58417578-58417600 TTGTTGATGGTGAAGTTGGAAGG + Intergenic
1099676728 12:85770419-85770441 CTGTCCAAGTTGAAGTCTCAAGG + Intergenic
1102423538 12:112823010-112823032 CTTTTGAAGTTGCAGCTGCAGGG + Intronic
1102426102 12:112845514-112845536 CTGGTGAAGATGAAGCTTCAGGG - Intronic
1103903820 12:124317220-124317242 CTTGTGGAGTTGAATTTGCATGG - Intergenic
1105465070 13:20632349-20632371 CTGTTCATGCTGAGGTTGCAGGG + Intronic
1106158212 13:27176966-27176988 CTGATGAAGGTCAAGTGGCAAGG - Intergenic
1106366225 13:29083479-29083501 CTGTTGAAGTGGGAGCTGAATGG + Intronic
1106892092 13:34256696-34256718 CTGTTGAAGTTGACCTGGGAAGG + Intergenic
1106972901 13:35165304-35165326 CTGCTAATGTTGAAGTTTCAAGG - Intronic
1107678672 13:42824338-42824360 CTGTAAAAGTTGAAATTTCATGG + Intergenic
1107686327 13:42903406-42903428 CTGTTGGAGTGGAGGATGCAGGG + Intronic
1108922081 13:55688591-55688613 CTGGGGAAGTTGAGGCTGCAGGG - Intergenic
1113055534 13:106263118-106263140 CTCTTGAAGTGGAAGGTGGAAGG - Intergenic
1114583739 14:23790220-23790242 GTGTAGAAGTTCAAGTGGCAAGG - Intergenic
1116048986 14:39780909-39780931 CTGTTGCAGTGGAGGTGGCAGGG + Intergenic
1116655435 14:47647238-47647260 CTTTTGAAGTTGATTTTGTAAGG - Intronic
1120239231 14:81930460-81930482 CTGTTGACTTGGAAGTTGCATGG - Intergenic
1121551267 14:94803108-94803130 CTCTGGAAGTGGAGGTTGCAGGG + Intergenic
1202936816 14_KI270725v1_random:95640-95662 CTATTGAATTTGTAGTTGCATGG + Intergenic
1123396384 15:19942116-19942138 CTTTTGAATTTCTAGTTGCATGG - Intergenic
1124128496 15:26962598-26962620 CTGTTGAAGGTGTATTTTCAGGG - Intergenic
1125050635 15:35294500-35294522 CTGTTGAAGTTGAAGTTGCAAGG - Intronic
1129408419 15:75335460-75335482 CTATTGATGTTGAAGCTGTAGGG + Intergenic
1129471512 15:75757973-75757995 CTATTGATGTTGAAATTGTAGGG + Intergenic
1129733484 15:77945176-77945198 CTGTTGATGTTGAAGCTGTAGGG - Intergenic
1131371650 15:91886928-91886950 CAGCTGAAGTTGCAGTTGCGTGG + Intronic
1133008565 16:2897809-2897831 CTTTTGAACTGGAAGTTCCAGGG + Intronic
1134573324 16:15310290-15310312 CTGTGGGCTTTGAAGTTGCATGG + Intergenic
1134729059 16:16445668-16445690 CTGTGGGCTTTGAAGTTGCATGG - Intergenic
1134938376 16:18266197-18266219 CTGTGGGCTTTGAAGTTGCATGG + Intergenic
1135012110 16:18891003-18891025 CTGTTGAATTAGAATTTGGAGGG - Intronic
1135318966 16:21478227-21478249 CTGTTGAATTAGAATTTGGAGGG - Intergenic
1135371863 16:21910020-21910042 CTGTTGAATTAGAATTTGGAGGG - Intergenic
1135439924 16:22460684-22460706 CTGTTGAATTAGAATTTGGAGGG + Intergenic
1136284293 16:29232202-29232224 CTGCTCAAGATGGAGTTGCAGGG - Intergenic
1136329271 16:29560297-29560319 CTGTTGAATTAGAATTTGGAGGG - Intergenic
1136443900 16:30300008-30300030 CTGTTGAATTAGAATTTGGAGGG - Intergenic
1136504172 16:30692246-30692268 CTGGTGAAGTGAAAGTTGGATGG - Intergenic
1136698859 16:32114269-32114291 CTTTTGAATTTCTAGTTGCATGG - Intergenic
1136737968 16:32480060-32480082 CTTTTGAATTTCTAGTTGCATGG + Intergenic
1136768749 16:32813558-32813580 CTTTTGAATTTCTAGTTGCATGG + Intergenic
1136799365 16:33057568-33057590 CTTTTGAATTTCTAGTTGCATGG - Intergenic
1136957040 16:34800515-34800537 CTTTTGAATTTCTAGTTGCATGG - Intergenic
1140853798 16:78959701-78959723 CTTTTGATGTGGTAGTTGCAGGG - Intronic
1141330501 16:83106733-83106755 TTGTTTAAGTTGAAGTGGAAGGG - Intronic
1142089328 16:88201708-88201730 CTGCTCAAGATGGAGTTGCAGGG - Intergenic
1203015105 16_KI270728v1_random:349517-349539 CTTTTGAATTTCTAGTTGCATGG - Intergenic
1203033440 16_KI270728v1_random:622675-622697 CTTTTGAATTTCTAGTTGCATGG - Intergenic
1203071167 16_KI270728v1_random:1075666-1075688 CTTTTGAATTTCTAGTTGCATGG + Intergenic
1144907861 17:18651242-18651264 CTCTATATGTTGAAGTTGCATGG - Intronic
1145693008 17:26764519-26764541 CTTTTGAATTTCTAGTTGCATGG - Intergenic
1148580422 17:48739460-48739482 CTGTTGAATCCGAAGTTGGATGG + Intergenic
1148723720 17:49773600-49773622 ATGGTGAAGATGGAGTTGCAGGG - Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149000472 17:51752364-51752386 ATGGAGAAGTTGAAGCTGCAGGG + Intronic
1149943987 17:60900895-60900917 CAGTTGTAGTTGAATTTGAAAGG + Intronic
1151917746 17:77131027-77131049 CTGTTGAACTGTAAGTTGCTTGG - Intronic
1152989491 18:349801-349823 CTGCTGACTTTGAACTTGCATGG + Intronic
1155152149 18:23131560-23131582 CTGTGGATGTAGAAGTTGCTTGG + Intergenic
1159438698 18:68449823-68449845 CTGGGGAAGGTGAAGTTTCATGG + Intergenic
1159528227 18:69621522-69621544 CTGAGGAAGTTGACTTTGCAAGG + Intronic
1162332981 19:10041780-10041802 CTGGTGAACTTGATGTTGTATGG - Intergenic
1167159992 19:47761028-47761050 CTTTGGAGGTTGAGGTTGCAGGG + Intergenic
1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG + Intronic
1202683003 1_KI270712v1_random:27436-27458 CTTTTGAATTTCTAGTTGCATGG - Intergenic
925629963 2:5882061-5882083 CTTTTGCAGAGGAAGTTGCAGGG - Intergenic
926254107 2:11175237-11175259 CTGCTTAAGTGGAAGTTCCATGG - Intronic
927203816 2:20594484-20594506 ATGCTGGGGTTGAAGTTGCAGGG + Intronic
928411968 2:31061227-31061249 CTGTTGAAATTGGAGTTGGGTGG - Intronic
929049490 2:37823923-37823945 GTGACGAAGTGGAAGTTGCAAGG + Intergenic
929273704 2:40002129-40002151 GTGTTTAAGTTGACTTTGCAGGG - Intergenic
931506776 2:62937069-62937091 CTCTTGAAGTTGAAATTGTTTGG + Intronic
931794666 2:65698019-65698041 CTGTTGAAGATGCTGTTGCTTGG + Intergenic
932890489 2:75592109-75592131 CTGGTCAAGGAGAAGTTGCAAGG + Intergenic
934248792 2:90327737-90327759 CTTTTGAATTTCTAGTTGCATGG + Intergenic
934260787 2:91475745-91475767 CTTTTGAATTTCTAGTTGCATGG - Intergenic
934304107 2:91807689-91807711 CTATTGAATTTGTAGTTGCATGG - Intergenic
934329148 2:92045061-92045083 CTATTGAATTTGTAGTTGCATGG + Intergenic
934467366 2:94274983-94275005 CTATTGAATTTGTAGTTGCATGG + Intergenic
934663424 2:96154923-96154945 GTGTGGAAGTTGGGGTTGCAGGG - Intergenic
935153312 2:100459780-100459802 CTTCTGAAGTTTAAGTTGCCTGG - Intergenic
938190997 2:129280604-129280626 CTGCTGTTGTTGAAGTTGAAGGG + Intergenic
938377374 2:130817136-130817158 CTGTTAAATTTGCATTTGCAGGG - Intergenic
940269135 2:151872417-151872439 CTGTTGATGTGGGAGTTGCTCGG + Exonic
941742357 2:169047990-169048012 CTGATGAAGTTACAGCTGCAGGG + Intergenic
941860148 2:170270865-170270887 CTTTTGTAGTTGAATTTGGATGG + Intronic
945274804 2:207977466-207977488 CTGTAGAAGTATAAGTTGTAAGG + Exonic
1169337289 20:4766724-4766746 CTGTAGAAGTGAAAGTTCCATGG - Intergenic
1175260559 20:57671460-57671482 TTCTGGAAGTTGAACTTGCAGGG - Intronic
1176586496 21:8593338-8593360 CTATTGAATTTGTAGTTGCATGG - Intergenic
1176743195 21:10626044-10626066 CTATTGAATTTGTAGTTGCATGG - Intergenic
1180269304 22:10570241-10570263 CTATTGAATTTGTAGTTGCATGG - Intergenic
1180534433 22:16385388-16385410 CTTTTGAATTTGTAGTTGCATGG - Intergenic
1203315210 22_KI270737v1_random:408-430 CTTTTGAATTTGTAGTTGCATGG + Intergenic
949909576 3:8890729-8890751 CTGTTGAAGTAGGGGTGGCAGGG - Intronic
953642289 3:44720256-44720278 CTGTGGATGTTGAATATGCAAGG + Exonic
954737286 3:52716929-52716951 CCGTTGAACTGGAAGTTGCAGGG - Intronic
955900959 3:63753780-63753802 ATGTTGAAGGTTAAGTTACAAGG - Intergenic
956160664 3:66348117-66348139 TTGTTGTTGTTGAAGTTCCAGGG - Intronic
956694590 3:71907521-71907543 GTGTTGAACTTGAACTTGGAGGG + Intergenic
957965011 3:87311031-87311053 CTAATGAAGTTTAAGTTTCAGGG - Intergenic
962252555 3:133845206-133845228 CATTTGAAGTTGAGGTTACAGGG - Intronic
963634851 3:147781619-147781641 CTGATGAATGTAAAGTTGCAGGG + Intergenic
964341343 3:155711838-155711860 CAGTTTTACTTGAAGTTGCAAGG + Intronic
964644996 3:158949374-158949396 CTGAGGAAGTTGAAGTTCCATGG - Intergenic
965049604 3:163628268-163628290 CTGTTGAAGTTATACTTTCAAGG + Intergenic
965298792 3:166984146-166984168 CTGTTGAAGTGAAAGTTGTCAGG + Intergenic
971955687 4:33415518-33415540 CTTCTGAAGTTTAAGTTGTATGG - Intergenic
972110830 4:35557209-35557231 CTGTGGAAGTGGAAGTGGTATGG - Intergenic
976869171 4:89769614-89769636 CTTTTGGAGGTCAAGTTGCAGGG - Intronic
980237876 4:130131927-130131949 TTGTTCCAGTGGAAGTTGCAGGG - Intergenic
981317613 4:143355977-143355999 CTGCTGAACATGAAGCTGCATGG + Intronic
983489258 4:168368824-168368846 CTGCTGGATTTCAAGTTGCATGG + Intronic
984170434 4:176351914-176351936 CTTCTGAAGTTTAAGTTGCCTGG + Intergenic
985909015 5:2864486-2864508 CTGTTGAAGTAGCAGTGGAAGGG + Intergenic
986893509 5:12338169-12338191 CTGCTGCAGTTGATGTTCCAGGG - Intergenic
987373292 5:17212648-17212670 CTATTCAAGATGGAGTTGCAAGG + Intronic
987413866 5:17642661-17642683 CTCTGGAGGTGGAAGTTGCAGGG - Intergenic
987571541 5:19668992-19669014 GTGTTGAAGTTGAAGTATCATGG - Intronic
987960676 5:24804350-24804372 CTCTTGAAGATGCAGTTACAGGG + Intergenic
989008210 5:36839393-36839415 CTGTTGCACTTGAACTTGCCTGG + Intergenic
989080292 5:37612063-37612085 GTGTTCAAGTTAAAGTAGCACGG + Intronic
989636050 5:43534888-43534910 CTCTATATGTTGAAGTTGCATGG + Exonic
990390466 5:55314557-55314579 CTCTAGAAGTGGAAGTGGCAAGG + Intronic
994408698 5:99379135-99379157 CTGTGGAAGATGAATTTGAAAGG - Intergenic
995909009 5:117163305-117163327 CTGTAGAAGCAGAAGTTTCATGG + Intergenic
997523943 5:134540705-134540727 CTGTTCAAGTTGAAGTGGGATGG + Intronic
997627097 5:135338515-135338537 CTGTTGTCGTTGCAGTTACACGG + Intronic
997872046 5:137514862-137514884 CTCTAGAAGGAGAAGTTGCAGGG + Intronic
998615593 5:143736708-143736730 CTGTTGTTGTTGAACTTGCATGG - Intergenic
1000784403 5:165526278-165526300 CTTTTGAAGTAGAAGTAACAAGG - Intergenic
1000965729 5:167653851-167653873 CTGTTGAACTTGCAGCTGAAAGG + Intronic
1001171620 5:169424834-169424856 ATGCAGAAGCTGAAGTTGCAAGG - Intergenic
1001455941 5:171859664-171859686 ATGTCTAAGTTGAAGCTGCAAGG + Intergenic
1005801075 6:29425685-29425707 ATGTTGATGTTGAAGCTGGATGG + Exonic
1006487963 6:34360152-34360174 CTGGGGAGGTTGAAGCTGCAAGG + Intronic
1007377919 6:41469064-41469086 TTAATGAAGCTGAAGTTGCAGGG + Intergenic
1008420957 6:51298630-51298652 CTGTTGAAATGGGAGTTGAAAGG + Intergenic
1009798564 6:68503199-68503221 CTGTTTTAGTGGAAGTGGCAGGG - Intergenic
1010058037 6:71588548-71588570 CTGCTTCAGTTGATGTTGCATGG - Intergenic
1010081909 6:71873372-71873394 CTGTTGAAGTTCAGGTTCCCAGG + Intergenic
1011011100 6:82705072-82705094 CTGCTGGATTTGAACTTGCATGG - Intergenic
1012759027 6:103273281-103273303 ATCTTGAAGTTGAAGGTACATGG - Intergenic
1014336093 6:120139470-120139492 CTGTTGACTTTGAAGTAGAAGGG + Intergenic
1014434242 6:121403665-121403687 CTCATGAAGCTGAAGTTTCAGGG + Intergenic
1015512985 6:134058094-134058116 CTAATGAAGTTTAAGCTGCAGGG + Intergenic
1017351130 6:153443188-153443210 CTTTTGAAGTTTAAGTTGTCTGG + Intergenic
1018179871 6:161213598-161213620 CTTTTGAAGTTTAAGTTGTCTGG - Intronic
1018245923 6:161823774-161823796 CTGCTGAAGCTGAAGCTTCAGGG + Intronic
1018344311 6:162884933-162884955 CTGTTTAAGTGTAAGTGGCATGG - Intronic
1020457996 7:8396121-8396143 CTGTGGCAGTTGAAGGTTCAAGG + Intergenic
1021509084 7:21415824-21415846 CTATTGAAGCTTAAGTTTCAAGG + Intergenic
1022788165 7:33659905-33659927 CTGTATAAGATGAAGGTGCAAGG - Intergenic
1023173740 7:37415373-37415395 CTCTTGATGTTGAAGATGTAGGG - Intronic
1023356326 7:39370809-39370831 ATGTTGAAGTTCAAGTTCAAAGG - Intronic
1025307137 7:57870728-57870750 CTTTTGAATTTGTAGTTGCATGG + Intergenic
1025481549 7:60990445-60990467 CTTTTGAATTTCTAGTTGCATGG - Intergenic
1026462596 7:70628239-70628261 CTCTTGAAGCTTAAGCTGCAGGG + Intronic
1030345754 7:108431279-108431301 CTGTGGCAGTGGAAGTGGCACGG - Intronic
1031077550 7:117227309-117227331 CTGTTGAAGTTGTGGTTGAGTGG - Intronic
1033157913 7:138972197-138972219 CTGTGGATGTTGAACTTGCCTGG - Intronic
1033502959 7:141972133-141972155 CTCTTGAAGTTGAAGTTATGTGG + Intronic
1033740899 7:144274995-144275017 TTGTTTAAGTGGAACTTGCATGG - Intergenic
1033753007 7:144374618-144374640 TTGTTCAAGTGGAACTTGCATGG + Intronic
1034180266 7:149131797-149131819 CTATTGAATTTGAAGTAGCGGGG + Intronic
1035866757 8:3092444-3092466 ATTCTGAAGTTGGAGTTGCATGG - Intronic
1036854651 8:12231461-12231483 CTGTGGAGGTTGAAGTGGGAGGG + Intergenic
1038511895 8:28145581-28145603 CTGGTGAAGCTGAACTTACAAGG + Intronic
1038665913 8:29537794-29537816 CTGTTGAAGTTGATTTTCCAAGG + Intergenic
1040571982 8:48619502-48619524 CTGTTGGAGTTCAACCTGCATGG + Intergenic
1041781410 8:61580950-61580972 CAGTTGCAATTTAAGTTGCATGG - Intronic
1042587652 8:70359553-70359575 CTCTTGAAGGGGAAGTTACAAGG + Intronic
1043005290 8:74810939-74810961 CTGTTGAAGTGGATCTTGCTTGG + Intronic
1047432200 8:124802572-124802594 CTACTGAAGTGGAAGTTACAAGG - Intergenic
1049448417 8:142642792-142642814 CTTCTGAAGTTTAAGTTGCCTGG + Intergenic
1050063105 9:1731049-1731071 CTGTAGACGTTGAATCTGCAAGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052423364 9:28272674-28272696 TTGTTGAAGTTGAGGTTCAAGGG - Intronic
1053386444 9:37694346-37694368 CTGTTTAACTTGATGTTGCCTGG + Intronic
1053697785 9:40653080-40653102 CTATTGAATTTGTAGTTGCATGG + Intergenic
1053943795 9:43283265-43283287 CTATTGAATTTGTAGTTGCATGG + Intergenic
1054309076 9:63452488-63452510 CTATTGAATTTGTAGTTGCATGG + Intergenic
1054407870 9:64776606-64776628 CTATTGAATTTGTAGTTGCATGG + Intergenic
1054441017 9:65260436-65260458 CTATTGAATTTGTAGTTGCATGG + Intergenic
1054489260 9:65761054-65761076 CTATTGAATTTGTAGTTGCATGG - Intergenic
1055187074 9:73470380-73470402 CTGCTGCAGTTGAGGTAGCAGGG + Intergenic
1056980986 9:91311897-91311919 CTCTTGAAGTTTAGGTTGCCTGG - Intronic
1060289515 9:122287725-122287747 TTGTTCAAGTTGAAATTCCATGG + Intronic
1202780164 9_KI270717v1_random:26480-26502 CTATTGAATTTGTAGTTGCATGG + Intergenic
1203586930 Un_KI270747v1:11842-11864 CTATTGAATTTGTAGTTGCATGG + Intergenic
1203616401 Un_KI270749v1:70847-70869 CTATTGAATTTGTAGTTGCATGG - Intergenic
1185570475 X:1131118-1131140 ATGTTGAAGTTGTACTTGCGGGG + Intergenic
1185931174 X:4205091-4205113 CTGTTGAGGCTGAAGAGGCAGGG + Intergenic
1186761379 X:12726375-12726397 CTGGTTAATTTGAAGTTGAATGG - Intergenic
1187441108 X:19321034-19321056 ATGTTGAAGTTCAAGTTTGAAGG + Intergenic
1191162678 X:57348250-57348272 CAGTTGACGTGGTAGTTGCAGGG - Intronic
1194375027 X:93121999-93122021 CTTATGAAGTTGCAGTTGAAGGG + Intergenic
1195545551 X:106108517-106108539 CTGTTGAAACTTAATTTGCAAGG - Intergenic
1195676878 X:107513300-107513322 CAGCTGAAGAGGAAGTTGCAGGG + Intergenic
1197295617 X:124715778-124715800 CTGTGGAAAATGAAGTTGAACGG - Intronic
1200751409 Y:6947388-6947410 CTTTTGAAGTTTAAGTTGTCTGG + Intronic
1201194919 Y:11482991-11483013 CTTTTGAATTTCTAGTTGCATGG + Intergenic