ID: 1125051173

View in Genome Browser
Species Human (GRCh38)
Location 15:35299485-35299507
Sequence GGGCCGCGGTGGCGGCAGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 856
Summary {0: 1, 1: 0, 2: 9, 3: 109, 4: 737}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125051162_1125051173 -2 Left 1125051162 15:35299464-35299486 CCGCCCGCCGACTCTGCCCATGG 0: 1
1: 0
2: 2
3: 11
4: 166
Right 1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG 0: 1
1: 0
2: 9
3: 109
4: 737
1125051161_1125051173 -1 Left 1125051161 15:35299463-35299485 CCCGCCCGCCGACTCTGCCCATG 0: 1
1: 0
2: 1
3: 21
4: 170
Right 1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG 0: 1
1: 0
2: 9
3: 109
4: 737
1125051166_1125051173 -6 Left 1125051166 15:35299468-35299490 CCGCCGACTCTGCCCATGGGCCG 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG 0: 1
1: 0
2: 9
3: 109
4: 737
1125051167_1125051173 -9 Left 1125051167 15:35299471-35299493 CCGACTCTGCCCATGGGCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 144
Right 1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG 0: 1
1: 0
2: 9
3: 109
4: 737
1125051160_1125051173 3 Left 1125051160 15:35299459-35299481 CCGGCCCGCCCGCCGACTCTGCC 0: 1
1: 0
2: 1
3: 37
4: 403
Right 1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG 0: 1
1: 0
2: 9
3: 109
4: 737
1125051165_1125051173 -5 Left 1125051165 15:35299467-35299489 CCCGCCGACTCTGCCCATGGGCC 0: 1
1: 1
2: 3
3: 23
4: 182
Right 1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG 0: 1
1: 0
2: 9
3: 109
4: 737

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125051173 Original CRISPR GGGCCGCGGTGGCGGCAGCG CGG Intronic
900138024 1:1126771-1126793 GGGCCGCTGAAGCCGCAGCGAGG - Intergenic
900155226 1:1201189-1201211 GGGCCGGGGTCGCGGCGGAGAGG - Intergenic
900246777 1:1639994-1640016 GGGCAGCAGTGACAGCAGCGCGG + Intronic
900257999 1:1707126-1707148 GGGCAGCAGTGACAGCAGCGCGG + Intronic
900303197 1:1988271-1988293 GGGTGGCGCTGGGGGCAGCGGGG + Intronic
900527260 1:3135289-3135311 GGTCTGCGGTGGGGGCAGGGCGG + Intronic
901066501 1:6497087-6497109 GCACCGCGGTGGGGGCAGAGCGG + Exonic
901078616 1:6571167-6571189 GGGCGGCTGTGGTGGCAGCACGG - Exonic
901109977 1:6785964-6785986 GGTCCACGGTGGGGGCCGCGGGG + Intronic
901148508 1:7084649-7084671 GGGACGCGGAGGGTGCAGCGGGG + Intronic
901453520 1:9350623-9350645 GGGTGGCGGTGGCAGCAGCAGGG + Intronic
901632304 1:10653785-10653807 TGGCGGCAGTGGCGGCAGCCAGG + Exonic
901641317 1:10694520-10694542 GGGCCGAGGAGGCGGCGCCGCGG - Intronic
901641334 1:10694583-10694605 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
902286200 1:15410066-15410088 GGGCAGCGGCGGCGGCGGCGGGG + Exonic
902950984 1:19882642-19882664 TGGCGGCGGCGGCGGCTGCGAGG + Exonic
903263367 1:22142948-22142970 GGGCAGCGGCTGCGGCCGCGGGG + Exonic
903413958 1:23168730-23168752 AGGCGGCGGCGGCGGGAGCGCGG - Intronic
903652443 1:24930155-24930177 GGGCCGCGGCGGGGCCCGCGCGG + Intronic
903822117 1:26111183-26111205 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
903855636 1:26336450-26336472 GGGCCGAGGGCGCGGCCGCGGGG - Intronic
903950675 1:26994303-26994325 CGGCCGCGGCGGCCGCGGCGCGG - Exonic
904641977 1:31938015-31938037 GTCCGGCGGTGGCGGGAGCGAGG + Exonic
904652235 1:32014174-32014196 CAGCAGCGGTGGCGGCTGCGTGG - Exonic
904822955 1:33256831-33256853 CGGCGGCGGCGGCGGCAGCGGGG + Intronic
905137076 1:35808176-35808198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905137124 1:35808343-35808365 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905239396 1:36572123-36572145 GGGCCGAGGTGGGGACAGCTGGG - Intergenic
905239403 1:36572143-36572165 GGGCCGAGGTGGGGACAGCTGGG - Intergenic
905408438 1:37752982-37753004 GGGCCGCAGGTGCAGCAGCGTGG + Exonic
905409887 1:37761435-37761457 GGGCCGCTGCAGCTGCAGCGCGG - Exonic
905414442 1:37794606-37794628 GGGGGGCTGTGGCGGCCGCGGGG - Exonic
905449304 1:38046692-38046714 GGGCCCCGGTGGCGGAGCCGGGG - Exonic
905463092 1:38134050-38134072 GGGCCGGGGTGGGGGCCTCGCGG + Intergenic
905617201 1:39409220-39409242 GGGCCGCGGGGCCAGCGGCGTGG + Intronic
905625996 1:39491176-39491198 GGGCCGCGGTGGCCGGAACCCGG + Intergenic
905947767 1:41918106-41918128 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
906204332 1:43979170-43979192 GGGCCGCGGGGGCGCGCGCGCGG + Intronic
906204409 1:43979377-43979399 GGGCCGCGGTGGCCGCTGACCGG + Intronic
906204502 1:43979647-43979669 GGGGCGGGGTGGGGGCAGCCAGG - Intronic
906480943 1:46198454-46198476 CGGCGGCGGCGGCGGAAGCGGGG - Intronic
906525243 1:46489841-46489863 TGGCAGCGGAGGCGGCGGCGCGG + Intergenic
906529098 1:46512944-46512966 GAGCCGCGGAGGCTGCAGGGAGG - Exonic
906640564 1:47438398-47438420 GGGGGGCGGCGGCCGCAGCGGGG + Exonic
907278088 1:53327951-53327973 GAGACGCGGCGGCGGCGGCGCGG - Exonic
907278105 1:53328015-53328037 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
907429960 1:54406034-54406056 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
907896785 1:58699996-58700018 GGGACGTGGTAGCGGCGGCGGGG - Exonic
908534759 1:65067154-65067176 GGAGCGCGGGGGCGGCGGCGCGG - Intergenic
910759108 1:90718026-90718048 CGGCCTCGGTGGCGGGGGCGCGG - Intergenic
911017242 1:93346184-93346206 CGGCGGCGGCAGCGGCAGCGGGG + Exonic
912429421 1:109621148-109621170 GGACCACGGCGGCGACAGCGGGG - Exonic
912993490 1:114511122-114511144 GGGCGGCGGCGGCGGCGACGCGG - Exonic
913109093 1:115641971-115641993 GTGCAGCGGCGGCGGCGGCGGGG + Exonic
913939232 1:125086688-125086710 AAGCCGCGGCGGCGGCAGGGGGG + Intergenic
914702948 1:150150386-150150408 GGGCCGCCGGGGCGGGGGCGCGG - Intronic
914902359 1:151717485-151717507 AGGCCGCGGAGGCGGCGCCGCGG + Intronic
915200116 1:154221009-154221031 CGGCGGCGGCAGCGGCAGCGCGG + Intronic
915325878 1:155080906-155080928 GGGCCGCGGCTGCCGCAGTGAGG - Intronic
915616990 1:157046224-157046246 CGGTGGCGGTGGCGGCGGCGGGG - Intergenic
915916958 1:159945988-159946010 GCGCCACAGAGGCGGCAGCGAGG + Intergenic
916651668 1:166839617-166839639 GGGCGGGGGCGGCGGCGGCGCGG + Intronic
916890259 1:169106618-169106640 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
916890367 1:169107026-169107048 TGGCCGGGGTGGCGGGGGCGAGG + Intronic
917121416 1:171647836-171647858 GGGCCACGGTGGCTGAGGCGAGG - Intronic
917310133 1:173669885-173669907 GCGCCGCGGTTCCGGCAGCGCGG + Intergenic
918365654 1:183805140-183805162 CGGCGGCGGCGGGGGCAGCGCGG + Intronic
919640244 1:200039319-200039341 GGGCAGCGGAGGCGACCGCGGGG - Intronic
920067211 1:203277402-203277424 GGGCCTGGGTGGGGGCAGCCAGG - Intergenic
920071342 1:203305357-203305379 GGGCTGGGGTGGCGGGGGCGGGG + Intergenic
920333325 1:205227965-205227987 GGGCCGCGGTCGCGGCTTTGCGG + Intergenic
920556635 1:206909357-206909379 GGATCGCGGCGGCGGCGGCGCGG + Intronic
921217736 1:212951476-212951498 CGGCAGCGGCGGCGGCGGCGGGG - Exonic
921603991 1:217135550-217135572 TGGCGGCGGCGGCGGCAGGGCGG + Intronic
922539411 1:226407783-226407805 GGGCCGCTGTGCGGGCGGCGGGG - Intronic
922665298 1:227464064-227464086 GGGCCAAGGTGGCGGCAAAGAGG + Intergenic
923372661 1:233328345-233328367 GGGCCGCGAGGGCGGCGGCGCGG - Exonic
923506544 1:234609992-234610014 GCGCCGGGGTGGCGGCGGCCGGG + Intergenic
924362269 1:243254726-243254748 GGGATGCGGAGGCGGCAGCAAGG + Intronic
924754779 1:246931477-246931499 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1062890460 10:1056430-1056452 GGGCCGCGGTGCCGGCCGCGCGG - Intronic
1063418239 10:5890304-5890326 GCCCGGCGGCGGCGGCAGCGGGG + Intronic
1063443070 10:6089144-6089166 GAGCCGCGCCGGCGGCAGAGCGG - Intronic
1064208973 10:13347779-13347801 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1064209080 10:13348113-13348135 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1065099605 10:22320849-22320871 GGGCCGGAGCGGCGGCCGCGCGG + Intronic
1065390187 10:25175067-25175089 GAGCGGCGGTGGCGGCAGCCGGG + Exonic
1065520569 10:26567283-26567305 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1066094075 10:32056206-32056228 CGGCAGCGGCGGCGGCACCGGGG + Exonic
1068690161 10:59906310-59906332 GGGCGGCGGCGGTGGCGGCGGGG - Exonic
1068953904 10:62804977-62804999 GGGCAGCCGTGGCGGCCGCCGGG + Exonic
1069019128 10:63465945-63465967 GCGGCGCGGTGGCGGCGGCTGGG - Intergenic
1069023983 10:63521168-63521190 GGGCCAAGGCCGCGGCAGCGAGG + Intergenic
1069456969 10:68561006-68561028 GCGCCGGGTTGGGGGCAGCGGGG + Intronic
1069689005 10:70337361-70337383 GGGATGCGGTGGCAGCAGGGAGG - Intronic
1069706280 10:70460649-70460671 GGGCCAGGGTGGAGGCAGGGAGG - Intergenic
1069769527 10:70888491-70888513 CGGCCGCGATCGGGGCAGCGGGG - Intronic
1070333071 10:75431664-75431686 GGGGCGCGGCGGCAGCAGCGGGG - Intronic
1071617995 10:87094275-87094297 GGGCCGCAGGGGAGGCAGGGAGG + Intronic
1072003568 10:91220815-91220837 CGGCGGCGGTGGCGGCCGCTGGG + Intronic
1072294204 10:93993899-93993921 CGGCTGCGCGGGCGGCAGCGGGG - Intergenic
1072926282 10:99620203-99620225 GGGCCGGGGGGCCGGCGGCGGGG - Exonic
1073099603 10:100999789-100999811 GCGCCGCGGAGGCGGAGGCGGGG + Exonic
1073110609 10:101061254-101061276 TGGCGGTGGTGGCGGCCGCGAGG + Intergenic
1073110916 10:101062591-101062613 GGGCCGCGGCGGCGGCAGCATGG - Exonic
1074161901 10:110842504-110842526 GGGCCGCGTTGCTGTCAGCGAGG + Intergenic
1074843284 10:117375437-117375459 GTGTGGCGGCGGCGGCAGCGGGG + Exonic
1074951540 10:118342089-118342111 GGGCCGCGGAAGCGACGGCGGGG - Intronic
1075651470 10:124130342-124130364 GGGCTGTGGTGGGGACAGCGGGG + Intergenic
1075697482 10:124447614-124447636 GGGCGGCGGCGGCGGCGGCTCGG - Exonic
1075768899 10:124917083-124917105 GGGCGGAGGCGGCAGCAGCGGGG + Intergenic
1076372495 10:129964388-129964410 GCGCGGCGGCGGCGGCGGCGAGG - Intergenic
1076722093 10:132397176-132397198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1076787197 10:132756850-132756872 GGGACGCAGAGGCGGCAGAGAGG + Intronic
1076792824 10:132785985-132786007 GGGCAGGGGCGGCGGCGGCGGGG - Exonic
1076900692 10:133336110-133336132 AGGCTGCGGTGGCGCCCGCGGGG - Intronic
1076922107 10:133459521-133459543 GAGCCGCTGTGACGGCCGCGTGG + Intergenic
1076986021 11:236454-236476 GGGGCGCGGAGGCGGGACCGGGG - Intronic
1077101547 11:824745-824767 GGTCCGCGGGGGCGGGAGCCGGG - Exonic
1077350940 11:2092928-2092950 GGGCCAGGGTGGCTGCAGAGGGG - Intergenic
1078057339 11:8019068-8019090 GGGGCGCGGCTGCGGCAGCCTGG - Intergenic
1078190834 11:9091567-9091589 GGGCGGTGGCGGCGGCGGCGCGG + Exonic
1078190913 11:9091774-9091796 CGGCCGCGGTGGCCCGAGCGCGG + Intronic
1078514320 11:12009273-12009295 GGGCCGCGGGTGCGGGAGCGCGG + Intronic
1080283599 11:30585388-30585410 CGGCCCCGGGGGCGGCCGCGGGG + Intronic
1081977130 11:47242812-47242834 GGGCAGCGGTGAGGGCAGCCAGG + Exonic
1082280613 11:50267858-50267880 GGGCGGCGGTGGCGGCTCCCGGG + Intergenic
1082807296 11:57459290-57459312 GAGCCGCGGCGCGGGCAGCGGGG + Intergenic
1083448461 11:62726818-62726840 GGGCTCCGGCGGCGGCTGCGCGG + Exonic
1083616379 11:64028550-64028572 GGGCCGCGGAGGGAGCAGAGGGG - Intronic
1083945033 11:65918974-65918996 GGGGCGCGGTGGCGGTGGCGCGG - Exonic
1084083247 11:66842961-66842983 GGGCCGCGGTGGCTTCCGGGCGG - Exonic
1084151355 11:67289317-67289339 CGGCGGCGGCGGCGGCAGCGCGG - Exonic
1084151373 11:67289358-67289380 GGGCCGCGGGGGGCGCAGCTGGG + Exonic
1084284199 11:68121096-68121118 GAGCTGCGGTAGCGGCAGCGCGG - Exonic
1084310228 11:68312516-68312538 GGGCGCGGGTGGCGGCGGCGGGG + Intergenic
1084592523 11:70098795-70098817 GGGCCACGGGGGCTGTAGCGGGG + Intronic
1084758106 11:71251863-71251885 GGGCCAGGGTGACCGCAGCGGGG + Intronic
1084787063 11:71448567-71448589 GGGCCGGTGGGGCGGCAGGGCGG - Intronic
1085044007 11:73343094-73343116 GCGCCGGGGTGGCGGCGGGGCGG - Intronic
1085197939 11:74683552-74683574 GGGCCGCGGGGGCGGCGGGACGG - Intergenic
1085208107 11:74749190-74749212 GGGCCGCGGGCGCGGCAGCGAGG - Exonic
1085332959 11:75668223-75668245 CGGCGGCGGTGGCTGCGGCGGGG + Exonic
1085408362 11:76277380-76277402 GGGCTGCAGTGGAGGCAGCCAGG - Intergenic
1086993441 11:93330644-93330666 GGGCCCAGGCGGCGGGAGCGCGG + Intronic
1087014623 11:93543239-93543261 GCGCGGCGGCGGCGGCGGCGGGG - Intronic
1087212375 11:95457237-95457259 AGGCCGCTGTGGCTCCAGCGTGG - Intergenic
1088400883 11:109422148-109422170 CGGCGGCGGCGGCAGCAGCGCGG + Exonic
1088677254 11:112206305-112206327 GGGCGGCAGGGGCGGCAGCTGGG + Intronic
1089289387 11:117428588-117428610 TGGCTGTGGAGGCGGCAGCGGGG + Exonic
1089432691 11:118436647-118436669 GGTCGGCGGTGGCGGCCCCGGGG + Exonic
1089993429 11:122882901-122882923 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1090238280 11:125165145-125165167 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1091108554 11:132944184-132944206 GGGGCGGGGTGGGGGGAGCGGGG + Intronic
1091439865 12:504439-504461 GGGGCGGGGGGGCGGCTGCGGGG - Intronic
1091550286 12:1530981-1531003 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1091616094 12:2052607-2052629 TGGCCGCGGTGGCCGCGGCGCGG - Intronic
1092335408 12:7628703-7628725 GGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1092880699 12:12885683-12885705 GGGGCGGGGGGGCGGCAGGGAGG + Intergenic
1093972344 12:25386391-25386413 GGGCCGCGGGCGGGACAGCGGGG + Intergenic
1094555693 12:31497807-31497829 GGGCAGCGGAGGGGGCAGGGAGG + Intronic
1095752619 12:45729048-45729070 AGGCCGTGGCGGCGGCAGAGAGG + Intergenic
1097057445 12:56258352-56258374 CGGCTGCGGTGGCGGCTGCAGGG + Exonic
1098255429 12:68611075-68611097 AAGCCGCGGCGGCGGCCGCGCGG + Intronic
1098550372 12:71755138-71755160 GGCCGGCGGCGGCGGCGGCGGGG + Exonic
1100611581 12:96195050-96195072 GGGCCCCGCTGCAGGCAGCGCGG + Intronic
1100830865 12:98515767-98515789 GAGGCTCGGAGGCGGCAGCGCGG + Exonic
1101081911 12:101195122-101195144 GGGGCGCGGTAGTGGCAACGGGG - Exonic
1101831096 12:108257253-108257275 GGGCTGTGGTGGTGGAAGCGAGG - Intergenic
1102184229 12:110935092-110935114 GGGCGGGGGTGGTGGCAGTGGGG + Intergenic
1102197156 12:111033973-111033995 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1102457137 12:113077853-113077875 TGGCGGCGGCGGCGGCAGCGGGG - Exonic
1102508171 12:113397193-113397215 TGCCTGCGGTGGTGGCAGCGTGG + Exonic
1103433068 12:120904248-120904270 GGGCGGCGGCGGCGGCGGCCGGG + Exonic
1103567281 12:121823072-121823094 GGGCAGCAGGGGTGGCAGCGGGG - Exonic
1103744288 12:123111624-123111646 AGGACGCGGTGGCGGTGGCGGGG - Intronic
1103749870 12:123151158-123151180 GAGCGGCGGCGGCGGCGGCGGGG + Intergenic
1103764669 12:123271665-123271687 GGGCGGCGGCGGCGGCGGCGAGG + Exonic
1103800356 12:123533735-123533757 CGGCGGCGGCGGCGGCAGCGGGG + Intergenic
1103822843 12:123712390-123712412 CGGCCGCGGTGGCAGAACCGGGG + Exonic
1103927035 12:124429004-124429026 GGGCCCCAGTGACGGCAGCCAGG + Intronic
1104847895 12:131855944-131855966 AGGGCGCCGTGGCTGCAGCGGGG + Intergenic
1104929319 12:132329691-132329713 GGGGCGCGGTGGGGGGGGCGGGG - Intergenic
1105217489 13:18297632-18297654 GGGCAGCGGCGGCGGCGGCTAGG + Intergenic
1105891718 13:24686897-24686919 GGGCTGGGGTGGGGGCAGGGAGG + Intronic
1106322966 13:28659278-28659300 TGGCGGCGGCGGCGGCAGCGTGG + Intronic
1106478031 13:30114805-30114827 GGGAGGCGGCGGCGGCGGCGGGG + Intergenic
1107534148 13:41311598-41311620 GGGACCGGGGGGCGGCAGCGCGG - Intronic
1107991227 13:45820634-45820656 GGGCCGCGGTGGTGGGAGGAGGG - Intronic
1110558511 13:76886257-76886279 TGGCGGCGGCGGCGGCGGCGGGG - Exonic
1110596585 13:77326776-77326798 CGGCGGCGGCGGCGGCGGCGAGG - Intronic
1112091797 13:96090809-96090831 CGGCGGCGGCGGCGGCAGGGCGG - Intergenic
1112344295 13:98577165-98577187 GGGCCGTGGGGGCGGGCGCGGGG - Intronic
1112505042 13:99970434-99970456 CGGCGGCGGCGGCGGCAGCCCGG + Exonic
1112733692 13:102394694-102394716 GGGCAGCGGCGGCGGGACCGGGG + Intronic
1113493624 13:110712408-110712430 GACCCGCGGCGGCCGCAGCGGGG + Intronic
1113541867 13:111115434-111115456 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1113820176 13:113208379-113208401 GGGCCGCCGTGGGGGCCGGGCGG - Intronic
1113885120 13:113654752-113654774 GAGCCGAGGAGGCGGCAGCCTGG + Intronic
1114508609 14:23237784-23237806 GGCTCGCGGTGGCGGGAGAGGGG - Intronic
1115235793 14:31207670-31207692 GGGCGACGGCGGCGGCGGCGCGG + Intronic
1115399144 14:32938833-32938855 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1115654426 14:35429785-35429807 GGGCGGCGGAGGCGGCACAGAGG + Intergenic
1115851784 14:37595141-37595163 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1116436180 14:44897479-44897501 CGGCGGCGGCGGCGGCAGCCCGG + Exonic
1116817888 14:49599860-49599882 GGGCCGGGGGGGCGGCCCCGCGG + Intronic
1117875891 14:60249617-60249639 AGGCGGCGGCGGCGGCAGCCGGG - Intronic
1117920792 14:60723768-60723790 GCGCGGCGGCGGCGGCGGCGTGG + Exonic
1118137431 14:63045301-63045323 GGGGCGCGGCGGCGGCGACGGGG + Exonic
1118186450 14:63542835-63542857 CGGGCGAGGTGGCCGCAGCGGGG + Exonic
1118849484 14:69573097-69573119 CGGCGGCGGCGGCGGCCGCGGGG + Exonic
1118911344 14:70064541-70064563 GGGTGGTGGTGGCGGCGGCGGGG + Intronic
1119003894 14:70907496-70907518 GGGTCGCGGCGGCGGCAGTGGGG + Exonic
1119410308 14:74426150-74426172 GCGCGGCGGCGGCGGCGGCGGGG - Intergenic
1119780025 14:77271183-77271205 GGGCGGCTCTGGCGGCTGCGGGG - Exonic
1120167902 14:81220357-81220379 CGGCGGCGGCGGCGGCCGCGCGG + Intronic
1121050439 14:90816332-90816354 GCGCCGCGGCGGCGGCGGTGGGG - Exonic
1121052436 14:90828281-90828303 GGGCCGCGGCGGGGGCCGCAGGG + Intergenic
1121075000 14:91060502-91060524 GGGCCGCGGCAGCGGCTGCGAGG - Exonic
1121245231 14:92457243-92457265 AGGCCGCTGTGGCTGCAGCAGGG - Intronic
1121308657 14:92923251-92923273 GGGCTGCGGTGGCACCGGCGCGG - Exonic
1122183495 14:99971987-99972009 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1122445019 14:101761787-101761809 CGGCGGCGGCGGCGGCCGCGGGG + Exonic
1122929421 14:104926517-104926539 GGGCAGAGATGGCGGCAGAGTGG - Intronic
1122975332 14:105168543-105168565 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1122975385 14:105168735-105168757 TGGCTGCGGTGCCGGGAGCGCGG - Exonic
1123001945 14:105300593-105300615 GTGCCGCGGTTGCGGCGGCACGG - Exonic
1123024891 14:105419899-105419921 CGGCGGCGGCGGCAGCAGCGCGG + Exonic
1123025056 14:105420308-105420330 GGGCCGAGGGGGCGGCCGCGGGG + Intronic
1123032030 14:105456466-105456488 GGGCAGCGGGGAAGGCAGCGTGG - Intronic
1123630804 15:22258332-22258354 GCGCGGCGCGGGCGGCAGCGTGG + Intergenic
1124922311 15:34038911-34038933 CGGCGGCGGAGGCGGCGGCGGGG - Exonic
1124966246 15:34435218-34435240 GGGCCGCGGTGGCTGCAGTGAGG - Intronic
1124971126 15:34490500-34490522 GGGCGGCGGGGGCGGCGGCGGGG - Intergenic
1124982848 15:34581301-34581323 GGGCCGCGGTGGCTGCAGTGAGG - Intronic
1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG + Intronic
1125200730 15:37098988-37099010 GCGCAGCGGCTGCGGCAGCGCGG + Intronic
1126034959 15:44537199-44537221 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1126852399 15:52805379-52805401 AGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1127165765 15:56243783-56243805 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1127218084 15:56846324-56846346 GGGACATGGTGGCGGCAGCTGGG - Intronic
1127606508 15:60592470-60592492 GCGGCGCGGCGGCGGCAGAGGGG - Intronic
1128322518 15:66703342-66703364 CGGCGGCGGTGGCGGCGACGAGG + Exonic
1128344127 15:66842819-66842841 GGGCGGCGGCGGCGCCGGCGCGG + Intergenic
1128841472 15:70854235-70854257 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
1129334294 15:74843192-74843214 GGGCGGCGCTGGGGGCAGCGTGG - Exonic
1130115597 15:81002090-81002112 GGGCTGCGGCGGCGGGAGCCCGG - Exonic
1130348052 15:83067065-83067087 GGGCGGCGGCGGCGGCCCCGCGG + Exonic
1130362959 15:83207681-83207703 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1130390181 15:83447834-83447856 GGGCAGAGGTGGCGGCCGCGGGG + Intronic
1130564426 15:84981697-84981719 CGGCGGCGGCGGCGGGAGCGGGG + Intronic
1131053438 15:89362451-89362473 GGCCCGCAGTGACGTCAGCGCGG - Intergenic
1131144431 15:90002021-90002043 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1131367664 15:91853715-91853737 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1131367719 15:91853881-91853903 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1131827015 15:96330404-96330426 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1131832316 15:96361544-96361566 GGGTCCCGGCGGCGGCAGCCCGG + Intergenic
1132055558 15:98648545-98648567 TGGCAGCGGCGGCGGCGGCGCGG + Intergenic
1132414890 15:101612925-101612947 GGGTGGGGGTGGCGGCAGCCTGG - Intergenic
1132500452 16:282535-282557 GGGCAGCGGTGGGGGGAACGGGG + Intronic
1132553956 16:564625-564647 GGGGCGCTGTGGGGGCAGTGCGG + Intronic
1132580088 16:680706-680728 GGGCGGCGGCGGTGGCACCGGGG + Intronic
1132686820 16:1165710-1165732 GAGCCGGGGTGGGGGCAGGGAGG - Intronic
1132724251 16:1332089-1332111 GGGACGCGGTGGGGGAAGCAGGG - Intergenic
1132880560 16:2160066-2160088 GGGCTGGGGTGGAGGCAGCGAGG + Intronic
1132887781 16:2190023-2190045 GGGCAGGGGCGGGGGCAGCGAGG - Intronic
1133212873 16:4272868-4272890 TGGCGGCGGCGGCGGCGGCGAGG + Exonic
1133784357 16:8963367-8963389 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1134554648 16:15154821-15154843 GGGGCGCGGTGGGGGCGGGGCGG + Intergenic
1135821870 16:25692319-25692341 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1136110894 16:28063205-28063227 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1136173871 16:28504507-28504529 GGGCCGTGCTGGCTGCATCGTGG - Intronic
1136226987 16:28866141-28866163 GGGCGGGGGTGGGGGCAGCGGGG - Exonic
1136364874 16:29805403-29805425 GGGCTGCGGGGGCGGGACCGGGG + Intergenic
1136365157 16:29806367-29806389 GGGGCGGGGTGGGGGGAGCGAGG - Intronic
1136399510 16:30010069-30010091 GGGCGGCGGGGGCGGCGGGGAGG - Exonic
1136408520 16:30063738-30063760 GGGCAGCAGCGGGGGCAGCGAGG - Exonic
1136511007 16:30738333-30738355 CGGCGGCGGCGGCAGCAGCGGGG + Exonic
1136910512 16:34141220-34141242 GGGGCGGGGTGGGGGCAGGGCGG - Intergenic
1137244697 16:46692874-46692896 GGGCGGCGGTGGCGGTGGGGGGG + Intronic
1137454840 16:48610182-48610204 GGCCCGCGGCGGCGGCAAAGGGG - Exonic
1137665278 16:50246050-50246072 GGGGCGCGGGGGCGGGAGCCGGG - Intergenic
1137832169 16:51554279-51554301 AGGCCACGGTGGGGTCAGCGTGG + Intergenic
1138105629 16:54285960-54285982 TGGCGGCAGCGGCGGCAGCGCGG - Exonic
1138105698 16:54286157-54286179 GCGCAGCGCGGGCGGCAGCGCGG - Exonic
1138179320 16:54931408-54931430 CGGCGGCGGCGGCGGCCGCGGGG - Exonic
1138247625 16:55479279-55479301 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1138599856 16:58047838-58047860 GGGCCTTGGTGGCAGCAGGGGGG + Intergenic
1139451188 16:67029194-67029216 CGGCGGCGGCGGCGGCGGCGTGG + Intronic
1139595319 16:67954414-67954436 GGGCCGAGGTGAAGGCAGCCAGG + Intronic
1139957436 16:70699857-70699879 GTGCTGGGCTGGCGGCAGCGTGG + Intronic
1141132330 16:81444891-81444913 GCGCCGGGGTGGGGGCGGCGGGG - Intergenic
1141499369 16:84432996-84433018 AGGCAGGGGTGGCGGCAGGGAGG + Intronic
1141608579 16:85169249-85169271 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1141608761 16:85169902-85169924 CGGCCGCCGTGGCGGCGCCGGGG + Intergenic
1141665318 16:85462744-85462766 GGGACGAGGTGGTGGCTGCGAGG + Intergenic
1141698508 16:85631944-85631966 GGCCCGCCTTGGGGGCAGCGTGG + Intronic
1141831164 16:86510608-86510630 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1141839728 16:86567035-86567057 AGGACCCGGCGGCGGCAGCGCGG - Intergenic
1142049983 16:87951725-87951747 GGGCCGGGGGTGCGGAAGCGAGG - Intronic
1142116231 16:88357491-88357513 GGGCCTCGGTGGCATCAGCCAGG + Intergenic
1142142674 16:88479548-88479570 GGGCCACGGTGGGGACAGAGAGG - Intronic
1142262533 16:89049647-89049669 GGGAGGCGGAGGCGGCAGGGAGG + Intergenic
1142336096 16:89490350-89490372 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1142408512 16:89904316-89904338 GGGCTGTGGTGGCGGCCTCGGGG + Intronic
1142631441 17:1229008-1229030 GGGGGGCGGCGGCCGCAGCGGGG - Intronic
1142762771 17:2051350-2051372 GGGGCGCGGAAGCGGCGGCGGGG + Intergenic
1142764083 17:2056126-2056148 GGGCCCGGGCGGCGGCCGCGCGG - Intronic
1142836798 17:2593599-2593621 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1142957814 17:3533123-3533145 GGGCCAGGGTGGAGGCAGGGAGG - Intronic
1143021987 17:3921624-3921646 GGGCGGGGGTGGAGGCAGCGTGG + Intergenic
1143223654 17:5282376-5282398 GGGCGGCGGCGGCGGCGGCTCGG + Exonic
1143490203 17:7281678-7281700 GGCCCGCGGGGGCAGGAGCGAGG + Exonic
1143512627 17:7404850-7404872 GGGCGGGGGAGGCGGCCGCGCGG + Intergenic
1143527220 17:7479595-7479617 CGGCGGCGGCGGCGGCAGCGGGG - Intronic
1143590877 17:7885306-7885328 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1143805194 17:9420471-9420493 GGGCCACGGTGGCAGCAGATAGG - Intronic
1144021030 17:11240630-11240652 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1144021161 17:11241057-11241079 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1144724721 17:17496191-17496213 GGGCCGCGAGGGCGGGCGCGGGG + Exonic
1144775650 17:17783341-17783363 GGGCTGCGGAGGCGGCGGCGCGG + Intronic
1145694205 17:26774511-26774533 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1145928000 17:28662218-28662240 CGGCGGCGGTGGCGGCGGAGGGG + Exonic
1146132634 17:30291961-30291983 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1146356923 17:32142450-32142472 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1146398559 17:32487001-32487023 CGGCGGCGGCGGCGGCAGCTAGG - Exonic
1146896592 17:36545664-36545686 CGGCGGCGGCGGCGGCAGCTGGG + Exonic
1147393417 17:40123095-40123117 GGTCCGAGGCGGTGGCAGCGGGG - Intronic
1147431101 17:40371334-40371356 GGGCTGTGGCGGGGGCAGCGAGG - Intergenic
1147793080 17:43025281-43025303 GGGCGGGGGAGGCGGCGGCGGGG + Exonic
1147994707 17:44354407-44354429 GGGCGGCGGGGGCGGCGGCGAGG - Exonic
1148131943 17:45267379-45267401 GGGCAGCCGTGGCTGCAGTGGGG - Intronic
1148178080 17:45584879-45584901 GGGCAGCGGCAGCGGCGGCGGGG + Intergenic
1148338135 17:46855196-46855218 GGGCAGCAGTGGCTGCAGAGAGG + Intronic
1148445263 17:47733595-47733617 GCGTCGCGGGGGCGGCAGCCTGG + Exonic
1148495011 17:48048384-48048406 GGCCGGCGGTGGCGGCGGCGAGG + Exonic
1148551068 17:48551101-48551123 GGGCGGTGGCGGCGGCGGCGGGG - Exonic
1150060586 17:62065372-62065394 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1150407976 17:64919169-64919191 GGGCGGCGGCGGCGGCGGCGGGG + Intronic
1151297060 17:73193356-73193378 GGCCCGCGGTGGCCGGGGCGCGG - Exonic
1151853525 17:76706139-76706161 GGGCCTCTGTGACGGCAGTGTGG - Intronic
1151853529 17:76706160-76706182 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853533 17:76706181-76706203 GGGCCTCTGTGATGGCAGCGTGG - Intronic
1151853541 17:76706223-76706245 GGGCCTCTGTGACGGCAGAGTGG - Intronic
1151853549 17:76706265-76706287 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853553 17:76706286-76706308 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853560 17:76706328-76706350 GGGCCTCTGTGATGGCAGCGTGG - Intronic
1151853568 17:76706370-76706392 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853572 17:76706391-76706413 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1152222211 17:79075062-79075084 CGGCCGCGGCGGCGGCGGCCGGG + Exonic
1152547514 17:81009265-81009287 GGGCGGTGGTGGCGGGGGCGGGG - Intronic
1152590826 17:81211179-81211201 GGGCCTCTGTGGCCCCAGCGTGG - Intronic
1152600807 17:81261224-81261246 GAGCCGGGGTGGCGGGAGCCGGG - Intronic
1152631746 17:81413645-81413667 AGGCCGCGGGGGCTGCAGCAAGG + Intronic
1152729025 17:81960944-81960966 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1152777580 17:82212565-82212587 GGGCGGGGGTTGCGGCCGCGTGG - Intronic
1152921390 17:83068219-83068241 CGACAGCGGGGGCGGCAGCGGGG + Intergenic
1152921553 17:83068661-83068683 CGACAGCGGGGGCGGCAGCGGGG + Intergenic
1153285384 18:3450967-3450989 GGGCGGCGGGGGCGGGGGCGGGG - Intronic
1154171780 18:12057503-12057525 TGGCAGTGGTGGTGGCAGCGAGG - Intergenic
1154196541 18:12271435-12271457 GGGCCGCCGTGGGGGCTGCGGGG - Intronic
1155007459 18:21741377-21741399 GGGGCGCGGCGGCGACAGCTGGG + Exonic
1157383938 18:47247081-47247103 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1157867051 18:51196766-51196788 CGGCCGCGGCGGCGGCGGCGGGG - Exonic
1158259108 18:55588155-55588177 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1158392007 18:57051652-57051674 GGGCCAGGGTGGTGGCAGCAGGG + Intergenic
1158436001 18:57435842-57435864 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1158436007 18:57435854-57435876 GGGCGGCGGGGGCGGCGGCGGGG + Exonic
1158954139 18:62523552-62523574 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1159040576 18:63320037-63320059 CAGCGGCGGCGGCGGCAGCGCGG + Exonic
1159798237 18:72868237-72868259 GGGCCGCGGCGGCGGCAGCAAGG + Intergenic
1160011293 18:75108731-75108753 GGCCCTCGGTGGAGGCAGGGAGG - Intergenic
1160025389 18:75211660-75211682 AGGCGGCGGCGGCGGCCGCGCGG - Intronic
1160204728 18:76822966-76822988 GGGCCGCGGCAGGGCCAGCGGGG - Intronic
1160454841 18:78992948-78992970 GCGCCGGGGCGGGGGCAGCGGGG - Exonic
1160603720 18:80033815-80033837 GGGCGGGGGGGGCGGCAACGGGG - Intronic
1160733490 19:651582-651604 GGGCCCCGGGGGTGGCCGCGAGG - Intronic
1160738811 19:676606-676628 GGGGCGCGGCGGCGGCGGCGGGG + Intronic
1160860867 19:1236831-1236853 GGGGCGCGGGGGCGGCGGCCTGG + Intronic
1160904715 19:1446676-1446698 GGGCGGCGGGGGCGGCTGCGGGG + Intronic
1160930588 19:1567995-1568017 GGGCGGCGGCGGCGGCGGCGTGG - Exonic
1160967715 19:1753875-1753897 GGGCAGCGCGGGCGGCGGCGCGG + Exonic
1161069657 19:2253726-2253748 GGGCGGCGGCGGCGGCTGCAGGG + Exonic
1161101515 19:2424203-2424225 GGGCCGTGCTGGTGGCAGAGAGG + Exonic
1161104479 19:2436677-2436699 CGGCCGTGGTGGCGGGAGGGTGG - Intronic
1161150085 19:2702818-2702840 GGGGCGCGGGGCAGGCAGCGGGG + Intergenic
1161203644 19:3029213-3029235 GGGTTTCGGTGGCGGCGGCGCGG + Intronic
1161266411 19:3366686-3366708 GGGGCGCGGGGGCGCCGGCGGGG - Intronic
1161477444 19:4494343-4494365 GGGCAGCGGCGGCAGCAGCGGGG + Exonic
1162128248 19:8510887-8510909 GGGCCGCGGGGGCGCCGGGGCGG + Exonic
1162176204 19:8832269-8832291 GGGCCGCGCGTGGGGCAGCGGGG - Exonic
1162470927 19:10871662-10871684 GCGCAGCGGCGGCGGCGGCGGGG + Exonic
1162535840 19:11262478-11262500 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1162752683 19:12838505-12838527 AGGCGGCGGCGGCGGCGGCGCGG - Intronic
1162914075 19:13865181-13865203 GGGAGGGGGCGGCGGCAGCGGGG + Intronic
1162954500 19:14090779-14090801 GTGCGGCGGCGGCGGCGGCGGGG - Intronic
1163117968 19:15199914-15199936 GGGCCGGGGAGGGGGCTGCGGGG - Intronic
1163268686 19:16236161-16236183 AGGCCCCGGGGGTGGCAGCGAGG - Intronic
1163282312 19:16325322-16325344 GGGCGGCGGCGGCGGCTCCGGGG - Exonic
1163442457 19:17328770-17328792 GGGCGGGGGCGGCGGCAGCGGGG - Exonic
1163581982 19:18144617-18144639 TGGCAGTGGTGGCGGCAGTGGGG + Exonic
1163631397 19:18419620-18419642 GGGCCCCGGCGGCGGCGGCGTGG + Exonic
1164624174 19:29715405-29715427 GGGCCCCGGTGACAGCGGCGGGG - Intronic
1165097181 19:33416032-33416054 GGGCAGCTGTGGCGGCACAGGGG + Intronic
1165138343 19:33684812-33684834 CTGCCGCGGTGGCAGCAGCGGGG - Exonic
1165371367 19:35408453-35408475 GGGCCACGGAGGTGGCAGCACGG + Intergenic
1165432569 19:35780985-35781007 CGGCAGCGGCTGCGGCAGCGGGG + Exonic
1165493913 19:36141038-36141060 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1166092569 19:40519739-40519761 GCGAGGCGGTGGCGGCAGCAGGG + Exonic
1166311914 19:41967632-41967654 GGGCAGGGCTGGGGGCAGCGGGG + Intronic
1166367303 19:42284195-42284217 GGGCGGCGGCGCCGGCAGCCGGG + Intronic
1166514932 19:43439434-43439456 GGGCCGGGGTGGAGGCGGCGGGG - Intergenic
1166873794 19:45885490-45885512 GGCCTGCGGGGGCGGCAGCTGGG + Exonic
1166882982 19:45940292-45940314 GGGAGGCGGGGGCGGCGGCGGGG + Exonic
1167048741 19:47066562-47066584 GGGTGGCGGTGGTGGCAGCGGGG + Exonic
1167072306 19:47228169-47228191 GGGCCTCGGGGCCGGCTGCGGGG + Exonic
1167072353 19:47228281-47228303 GGGCGGCGGGGGCGGCAGCCAGG + Exonic
1167145538 19:47679434-47679456 GGGCGGCGGCGGGGGCAGTGGGG + Exonic
1167152921 19:47719821-47719843 GGGCAGGGGTGCCGGCAGGGGGG + Intronic
1167456148 19:49597457-49597479 AGGCGGCGGTGGCGGAGGCGGGG - Exonic
1167473932 19:49689615-49689637 GAGCCGCGGTGCGGGAAGCGGGG + Exonic
1167578497 19:50328972-50328994 CGGCAGCGGTGGCGGCGGCGGGG + Exonic
1167601786 19:50459073-50459095 GGGGCGGGGTGGGGTCAGCGGGG - Intronic
1167643702 19:50695085-50695107 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1168076352 19:53982606-53982628 CGGCGGCGGAGGCGGCGGCGGGG + Exonic
1168242602 19:55095046-55095068 GCGCCGTGGTGGCAGCAGGGTGG + Intronic
1168247004 19:55117487-55117509 GGGCGGCGGCGGCGGCTGCCCGG - Exonic
1168315161 19:55481886-55481908 GGGCCGCGGAGGCGGTACCCGGG - Exonic
1168322180 19:55517245-55517267 GGGCCGCGGTGGCCGGCGCTCGG - Exonic
925609792 2:5693150-5693172 CGGCGGCGGCGGCGGGAGCGCGG + Exonic
925929261 2:8694103-8694125 GGGGGGCGGTGGGGGCAGTGGGG + Intergenic
926077219 2:9951334-9951356 GGGCGGCGGGGGCGGTGGCGGGG + Intergenic
926083916 2:10009521-10009543 GGGATGCGGTGGCAGCAGCCGGG + Intergenic
926089877 2:10043198-10043220 GGGCGGCGGGGGCGGCGGGGCGG - Intronic
927510794 2:23642689-23642711 TGGCGGCGGTGGAGGCAGCAGGG - Exonic
927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG + Intronic
929133501 2:38602161-38602183 GCGGCGCGGCGGCGGCGGCGGGG - Intronic
929218116 2:39437111-39437133 CGGCGGCGGCGGCCGCAGCGTGG - Exonic
929604187 2:43224565-43224587 GGGCGGCGCCGGCGGCTGCGCGG + Exonic
931253509 2:60552425-60552447 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
931517832 2:63059941-63059963 GGGCAGCGGCGGCGGGAACGCGG + Intergenic
931728043 2:65129948-65129970 GGGCGGCGGCTGCGGCAGCAAGG - Exonic
932213159 2:69948517-69948539 AGGCCGCAGTGGGGGCAGCTTGG + Intergenic
932288271 2:70554288-70554310 GGGCCGCAGTGGCGGCTTCCAGG + Intergenic
932593259 2:73079712-73079734 AGGCTGGGGTGGCTGCAGCGAGG + Intronic
932593710 2:73081500-73081522 CGGCAGCAGTGGCAGCAGCGGGG + Intronic
932599256 2:73112742-73112764 GGGGCGCGGAGCCGGCGGCGGGG - Exonic
933666856 2:84971277-84971299 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
933684717 2:85133711-85133733 CGGCGGCGGCGGCGGCAGCGGGG + Exonic
933772774 2:85754554-85754576 AGGCGGCGGCGGCGGCGGCGTGG - Exonic
934248189 2:90324702-90324724 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248362 2:90325312-90325334 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248373 2:90325350-90325372 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248405 2:90325467-90325489 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934261189 2:91478099-91478121 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
934296816 2:91749019-91749041 GGGCCGCGGCGGCGGCGGCGAGG - Intergenic
934566977 2:95346598-95346620 GGGGCGCGGCGGCGGCGGCGCGG - Intronic
935021588 2:99237566-99237588 GGTCAGCGGTGGGGGCAGTGTGG + Intronic
935592444 2:104855295-104855317 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
935592558 2:104855612-104855634 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
935592610 2:104855816-104855838 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
935592737 2:104856230-104856252 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935592783 2:104856392-104856414 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
936122700 2:109760441-109760463 GGGCGGCGGCGGCGGCGGCGCGG + Intergenic
936126703 2:109794590-109794612 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
936221993 2:110611032-110611054 GGGCGGTGGCGGCGGCGGCGCGG - Intergenic
936390783 2:112071310-112071332 GGGCAGTGGTGGCGGCGGCGGGG - Intronic
936939640 2:117871067-117871089 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
937221813 2:120346298-120346320 TGGCGGGGGTGGCGGCGGCGCGG - Exonic
937335403 2:121059366-121059388 GGGCAGAGGTGGCTGCAGCTGGG + Intergenic
938253430 2:129833706-129833728 TGGACGGGGTGGCGGCAGGGCGG - Intergenic
938271855 2:129979678-129979700 GGGCTGCGGCGGCGGCGGCTGGG + Exonic
938444146 2:131364122-131364144 GGGCTGCGGCGGCGGCGGCTGGG - Intergenic
939153888 2:138502013-138502035 AGGCTGCGGTGGTGGCAGCAGGG - Exonic
940265135 2:151828362-151828384 GTGCCGCGGCGGCAGCGGCGGGG - Exonic
940830051 2:158456989-158457011 CGGCCGCGGAGGCGGCACCATGG + Intronic
942083988 2:172427695-172427717 TGGCTGCGGTAGCAGCAGCGCGG + Intronic
942120678 2:172773637-172773659 GGTCCGCGGGGGGGGCAGTGTGG - Intronic
942450900 2:176107586-176107608 CGGCGGCGGCGGCGGCAGCGCGG + Exonic
942451048 2:176108072-176108094 AGGCAGCGGTGGCGACGGCGAGG + Exonic
942970830 2:181956042-181956064 GGGCAGGGGTGGCGGCGGGGAGG - Intronic
946019842 2:216633546-216633568 CGGCGGCGGCAGCGGCAGCGCGG - Exonic
946692418 2:222319502-222319524 GGGCGGCGGTGGCGGGGCCGGGG + Intergenic
946692489 2:222319771-222319793 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
946921427 2:224585155-224585177 GGGCAGCCGCGGCGGCGGCGGGG + Exonic
947641565 2:231710195-231710217 CTGCCGGGGTGGCGGCAGTGGGG + Intronic
947928108 2:233938868-233938890 GGGGCGGGGTGGGGGCAGCAGGG - Intronic
948206995 2:236167747-236167769 CGGCAGCGCTGGCTGCAGCGCGG + Exonic
948438128 2:237967396-237967418 TGACCGCGGCGGCGGCGGCGGGG + Intronic
948487238 2:238288710-238288732 GGGCGGCGGCGGCGGGCGCGGGG - Intronic
948645369 2:239400852-239400874 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
948824796 2:240568924-240568946 GGGCAGCGGGGGCGGCGGCGCGG - Exonic
1168802757 20:653534-653556 AGGCCGCGGGGGCGGGGGCGGGG + Intronic
1168878207 20:1185415-1185437 CGGCGGCGGTGGCGGCCGCTGGG + Intronic
1169065595 20:2692870-2692892 GGGCGGCGGCGGCCGCGGCGGGG + Exonic
1169278484 20:4248861-4248883 GGGCGGCGGCGGGGGCAGCGCGG - Exonic
1169557795 20:6768366-6768388 GGGCCGCGGCGGAGCTAGCGCGG + Exonic
1169558117 20:6770050-6770072 GGGCCGCGGGGGCGCGAGGGGGG + Intronic
1170150381 20:13221379-13221401 GGGCTGCGGGGTCGGCGGCGGGG - Intergenic
1170756799 20:19212474-19212496 GGGCGGCGGGGGCGGCCGGGAGG - Intergenic
1170924745 20:20712594-20712616 CGGCGGCGGCGGCAGCAGCGGGG - Intergenic
1171567399 20:26208312-26208334 GGGCCCCGGTGGCGGGACCAGGG - Intergenic
1172015432 20:31870262-31870284 GGGCCGCGGCGGCCGGGGCGGGG + Intronic
1172037311 20:32019127-32019149 GGGAGGCGGCGGCGGCAGCTTGG + Exonic
1172037337 20:32019235-32019257 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1172073657 20:32277705-32277727 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1172359798 20:34303889-34303911 GGGACGCGGAGGCGGGAGGGAGG + Intronic
1172474532 20:35226890-35226912 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1172568939 20:35954071-35954093 GGGCCGCGGAGGCCGCAGCTCGG + Exonic
1172698078 20:36835851-36835873 GAGCAGCGGCGGCGGCGGCGGGG - Intronic
1172702665 20:36862829-36862851 CGGCCGCGGGGGCTGCTGCGCGG + Exonic
1173827581 20:46057563-46057585 GGTCCGCGGCGGCGGCCGCGAGG + Exonic
1173843677 20:46174874-46174896 CGGCGACGGGGGCGGCAGCGCGG - Exonic
1173874803 20:46363851-46363873 GGGCCGCTGTGGCGGGTGCTGGG - Intronic
1173927226 20:46789821-46789843 GGGCAGCAGTGGCTGCAGCAGGG - Intergenic
1174386723 20:50191744-50191766 GGGGCGCCTTGGCGTCAGCGGGG - Exonic
1174494610 20:50930907-50930929 GCACGGCGGTGGCGGCAGCGGGG + Exonic
1174611426 20:51801454-51801476 TGGCCGGGGTGGCGGGCGCGCGG - Intronic
1174656391 20:52175854-52175876 TGGGGGCGGGGGCGGCAGCGGGG - Intronic
1175429534 20:58891705-58891727 TGGCGGCGGCGGCGGCGGCGGGG - Intronic
1175856455 20:62123098-62123120 CGGCCGAGGGGGCGGCACCGCGG - Intronic
1176020347 20:62959453-62959475 GGGCAGCAATGGCGGCTGCGTGG + Intronic
1176029798 20:63006476-63006498 GAGCAGCGGCGGCGGCGGCGCGG - Exonic
1176068922 20:63216016-63216038 GGGCGGCGGCGGCGGCTGCTGGG + Exonic
1176234839 20:64049393-64049415 GGGCGGCGGGGCCGGCGGCGAGG + Exonic
1176300300 21:5096133-5096155 GGCGGGCGGTGGCTGCAGCGTGG - Intergenic
1176576572 21:8443299-8443321 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1176952564 21:15064622-15064644 GGGCCGCGGGGGCGTCGGGGCGG - Intronic
1177431693 21:20998277-20998299 GGGCGGCGGGGGCGGGGGCGCGG - Intergenic
1178457763 21:32771521-32771543 GGGCCCCGGTGGCGGCGACAGGG - Exonic
1178487050 21:33025861-33025883 CGGCAGCGGTGGCGGGGGCGGGG - Intronic
1178487404 21:33027681-33027703 GGGCGGGGGCGGCGGCAGTGGGG + Exonic
1178493691 21:33070293-33070315 GGGCCGCTGTGGCCGCAGCATGG - Exonic
1178534867 21:33403267-33403289 GGGCCTCTGCGGCTGCAGCGCGG - Exonic
1178992264 21:37366346-37366368 GGGCTGCGGGGGCGGCGGCGCGG + Intronic
1179561585 21:42219221-42219243 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1179785833 21:43729095-43729117 GAGCCGCGGAGGCCGCAGCCAGG - Intronic
1179810222 21:43865288-43865310 GGGCCGCGGAGGCGACGCCGGGG + Intronic
1179856722 21:44165778-44165800 GGCGGGCGGTGGCTGCAGCGTGG + Intergenic
1180154952 21:45973212-45973234 GGGCCCCGGAGGCGGCTGCGAGG - Intergenic
1180801456 22:18633958-18633980 TGGCGGCGGTGGAGGCAGCAGGG + Intergenic
1180852690 22:19029498-19029520 TGGCGGCGGTGGAGGCAGCAGGG + Intergenic
1180949414 22:19714469-19714491 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1180972304 22:19821984-19822006 GGGCAGAGGTGGCAGCAGGGAGG - Intronic
1181220265 22:21361303-21361325 TGGCGGCGGTGGAGGCAGCAGGG - Intergenic
1181670544 22:24423837-24423859 GGGGCGGGGCGGGGGCAGCGCGG + Intronic
1182355360 22:29720295-29720317 GGGCGGCGGCGGCAGCGGCGAGG - Exonic
1182469867 22:30542109-30542131 GGGTCGCGGTGTGGGCAGGGTGG - Intronic
1182804378 22:33058078-33058100 GGGCCCCGGCAGCGGCAGCCTGG + Intronic
1183247220 22:36703249-36703271 CGGCGGCGGCGGCGGCAGGGCGG + Exonic
1183427210 22:37746315-37746337 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1183478918 22:38052296-38052318 GGACAGCGGTGGCTGCAGAGCGG + Intergenic
1183697595 22:39432032-39432054 GGGCTGTGGGGGCGGCAGCATGG - Intronic
1183743165 22:39679388-39679410 GGGCGGCGGGGGCGACACCGAGG + Exonic
1183829543 22:40410481-40410503 GGGCCACGCTGGCTGCAGTGAGG + Exonic
1183903478 22:41022640-41022662 TGCCCGCGGTGGGGGCAGGGAGG + Intergenic
1184109251 22:42385392-42385414 GGGCAGGGGTGGGGGCAGCATGG - Intronic
1184465898 22:44668775-44668797 TGGCAGCGGCGGCGGCGGCGCGG + Intronic
1184478940 22:44736188-44736210 GGGCCTCGCTGGCCGCTGCGTGG - Intronic
1184712752 22:46262842-46262864 GGGCCGCGGGGGAGGCCGGGCGG + Exonic
1184767031 22:46577395-46577417 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1185055202 22:48575677-48575699 CGGCCGCGGCGGCGGAGGCGCGG + Intronic
1185082639 22:48718337-48718359 GAGCCTCTGTGGGGGCAGCGGGG + Intronic
1185409435 22:50674426-50674448 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203254622 22_KI270733v1_random:132357-132379 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203262678 22_KI270733v1_random:177436-177458 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
950056152 3:10026401-10026423 GCGCCTCGGTGGCGTCAGAGCGG + Exonic
950215281 3:11154474-11154496 GTGTCGCGGGGGCGGCGGCGGGG - Intronic
950550134 3:13661311-13661333 GGGCCGGGGTGGTGGGAGGGGGG + Intergenic
950729789 3:14947615-14947637 CGGCGGCGGCGGCGGCACCGGGG + Intronic
952211241 3:31231263-31231285 GGGCAGCGGTGGGGTCAGTGGGG + Intergenic
952816631 3:37452591-37452613 GGGCCGGGGCGGTGGCCGCGCGG - Intronic
953545083 3:43858368-43858390 GGGCTGCGGAGGCAGCAGGGGGG - Intergenic
954201313 3:49025002-49025024 GGGCCTCAGTGGTGGCAGCCAGG + Exonic
954437423 3:50503467-50503489 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
954540633 3:51391266-51391288 GCGCGGCGGTGGCGGCGGGGCGG - Exonic
954795931 3:53161381-53161403 GGGTCGCGGCGGCAGCGGCGGGG - Exonic
955060460 3:55488229-55488251 GGGCGGCGGAGGCGGCTCCGTGG + Intronic
955387606 3:58492053-58492075 CGGCGGCGGCGGCGGCAGAGGGG - Intergenic
955911570 3:63863949-63863971 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
956129118 3:66038147-66038169 TGGCGGCGGTCGAGGCAGCGGGG - Exonic
959056947 3:101576509-101576531 TGGCCGCCGTGGCCGCACCGTGG - Intronic
961827168 3:129605283-129605305 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
962134755 3:132722194-132722216 GAGGCGCGGGGGCGGCAGCAGGG - Exonic
962230528 3:133661806-133661828 GGGACGCGCTGGCCGCAGGGCGG + Exonic
962277955 3:134030037-134030059 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
962575526 3:136752164-136752186 GGGCGGCGGCGACGGCGGCGGGG - Intronic
963870192 3:150408301-150408323 CGGCAGCGGCGGCGGCAGCGGGG + Intergenic
963904456 3:150762660-150762682 GGGCCCCGGCGGCGGCGGCGGGG - Exonic
964743260 3:159988851-159988873 GGGCCGAGCTGGAGGCGGCGGGG + Exonic
965560977 3:170062266-170062288 GTGCGGCGGAGGCAGCAGCGGGG + Intronic
965881762 3:173396063-173396085 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
966440815 3:179942416-179942438 GGACCGCGGAGGCGGCTGGGCGG + Intronic
966866098 3:184259958-184259980 CGGCCGCGGTAGCGGCGGCGCGG - Exonic
966866561 3:184261591-184261613 GGGGCGCGGTGGAGGCGGGGCGG + Intronic
967055338 3:185825099-185825121 CGGCCGCGGTGGGGGGAGCCAGG - Intergenic
967171753 3:186827441-186827463 GGGCCGCGGCGGCGGCAGAAAGG + Intergenic
967904031 3:194486588-194486610 AGGCCGCGGAGGAGGCGGCGCGG - Intronic
968341629 3:197960405-197960427 GGGACGTGGTGCCGGCAGGGAGG - Exonic
968434110 4:576196-576218 GGGCTCCGGCGGCGGCGGCGCGG - Intergenic
968515006 4:1012103-1012125 GGGGCGCGGGGGCGGGGGCGGGG - Intronic
968534336 4:1113769-1113791 GGGCCTGGGTGGCGGGCGCGGGG + Intergenic
968820193 4:2844094-2844116 GGGCCGCGGTTGCGGCGGGCGGG + Intronic
968850487 4:3074615-3074637 GGGCCGCGCCGGCGGAGGCGGGG - Intergenic
968850579 4:3075028-3075050 TGGCGGCGGGGGCGGCGGCGGGG - Exonic
969213916 4:5708383-5708405 GCGCCGAGGGGGCGCCAGCGGGG + Exonic
969431795 4:7159426-7159448 GGGAGGCGGTGGGGGCAGGGTGG - Intergenic
969531756 4:7734285-7734307 GGGCGGCGGTGGCGGCTACTGGG + Exonic
969532256 4:7736554-7736576 GGGTCCCAGTGGAGGCAGCGGGG + Intronic
969715851 4:8867786-8867808 GAGCAGCGGTGGGGGCGGCGCGG + Exonic
970194568 4:13542068-13542090 GGGCTGCAGTGGCAGAAGCGAGG + Exonic
970333012 4:15003723-15003745 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
970333032 4:15003782-15003804 GGGCAGCGGCGGCGGCGACGCGG - Exonic
970333046 4:15003833-15003855 GGGCTGGGGTGGCGGCGACGCGG - Exonic
971279798 4:25233913-25233935 CGGCGGCGGCGGCGGCAGCGGGG - Intronic
971406031 4:26321258-26321280 GGGCGGCGGCGGCGGCGGCGAGG + Intronic
971457807 4:26860791-26860813 GCGCCGCGGCGGCGGCGGCGCGG + Intronic
972265338 4:37454004-37454026 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
972396726 4:38664340-38664362 GGGCGGCGTTGGCGGCCGCAGGG - Exonic
973137315 4:46724423-46724445 GGGCCGCGGCGGCGGCGGCAGGG + Intergenic
973954427 4:56049103-56049125 GCCGCGCGGTGGCGGCAGTGGGG + Intergenic
975986259 4:80203237-80203259 CGGCTGCGGCGGCGGCCGCGGGG + Exonic
976199091 4:82561791-82561813 GGACGGCGGGGGCTGCAGCGCGG - Intronic
977257651 4:94758272-94758294 GTGGGGCGGTGGCGGCGGCGGGG + Intronic
977716571 4:100190267-100190289 CGGCCTTGGTGGGGGCAGCGGGG - Intronic
978295829 4:107203939-107203961 GGGCCGCAGGGGCAGCAGCAGGG + Intronic
978366653 4:107989906-107989928 TGGCAGCGGCGGCGACAGCGAGG - Exonic
978741669 4:112144958-112144980 CGGGCGTGGTGGCGGCAGTGTGG - Intergenic
982172846 4:152678522-152678544 GGGCGGCGGTGGGGGGAGGGGGG + Intronic
982288763 4:153759839-153759861 TGGCCGCGGGGACGGCGGCGCGG - Exonic
982573189 4:157076087-157076109 GGGCCGCAGCGGGGACAGCGCGG - Exonic
983577006 4:169271016-169271038 GGGAGGCGGCGGCGGCGGCGTGG - Exonic
983904437 4:173169212-173169234 GAGCCGCTGCCGCGGCAGCGCGG - Intronic
984206458 4:176792756-176792778 GGGCCGCGGGCGCTGCGGCGGGG + Intergenic
984852954 4:184169401-184169423 GGGCCGCGGGGAGGGCAGCAGGG + Intronic
985472193 5:53371-53393 GGGACTCGGGGGCGGCAGTGAGG - Intergenic
985896298 5:2751567-2751589 GGGCCGGGGCGGCGGCGGGGTGG + Exonic
986330850 5:6714714-6714736 AGGCCGCGGGGGCGGGGGCGGGG + Intronic
986813662 5:11385167-11385189 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
987087978 5:14487507-14487529 CGGCGGCGGCGGCGGCAGCGGGG + Exonic
987193240 5:15500349-15500371 GGGACCCGGCGGCGGCGGCGCGG + Exonic
988796447 5:34656799-34656821 GGGCCGCGGCGGAGGGAGCGCGG + Intronic
989812570 5:45695868-45695890 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
990825459 5:59893428-59893450 GGGCGAGGGTGGCGGCGGCGGGG + Exonic
990955028 5:61332326-61332348 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
992105723 5:73448035-73448057 GGGCGGCGGCGGCGGCGGCGCGG - Exonic
992487480 5:77210535-77210557 GGGCCGCGGGTGCGGGAGCCCGG + Intronic
992837448 5:80654757-80654779 GGGCTGAGCTGGAGGCAGCGAGG - Exonic
992939631 5:81750420-81750442 GGGCGGCGGTGCCGGGCGCGCGG - Intronic
992950439 5:81852367-81852389 GGGCAGCGGAGGCGGCAGGCGGG + Intergenic
994353836 5:98773863-98773885 AGTCCGCGGCGGCAGCAGCGGGG - Intronic
996690918 5:126338946-126338968 CGGCAGCGGTGGCGGCTGGGAGG - Intergenic
996978410 5:129461172-129461194 GGACCCGGCTGGCGGCAGCGGGG + Exonic
997201314 5:132011640-132011662 CGGCAGCGGCGGCGGCGGCGCGG - Exonic
998295633 5:140966738-140966760 TGGCCGCGGCGGAGGCAGCCGGG - Exonic
998467451 5:142357162-142357184 GGGCGGAGGAGGCGGAAGCGGGG - Intergenic
998562073 5:143181077-143181099 GGGCTGAGGTGGTGGCAGTGGGG - Intronic
999322613 5:150624744-150624766 CGGTGGCGGTGGCGGCGGCGAGG + Intronic
1001065052 5:168529531-168529553 GGGCGGTGGGGGCGGCCGCGGGG + Exonic
1001065057 5:168529543-168529565 CGGCCGCGGGGGCGGCGGCTGGG + Exonic
1001495977 5:172188048-172188070 GGGGCGCGGTGGCGCCGGCTCGG + Exonic
1001980648 5:176035315-176035337 GGGCTGCATTGCCGGCAGCGGGG - Intergenic
1002236813 5:177808750-177808772 GGGCTGCATTGCCGGCAGCGGGG + Intergenic
1002291848 5:178205369-178205391 GGGCCGCGCCGGCGGCTGCGTGG + Intronic
1002591068 5:180291969-180291991 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1002896619 6:1383580-1383602 GGGCTGCGGCGGCGGGAGGGAGG - Intergenic
1002927244 6:1611567-1611589 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1002927308 6:1611786-1611808 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1003121540 6:3322548-3322570 GGGCAGCGGTGGCTGCTGAGTGG + Intronic
1003175812 6:3751675-3751697 GGCCCGCGTTCGGGGCAGCGGGG + Exonic
1003567193 6:7231218-7231240 GGGCCGCAGTGGACGCAGCAAGG - Exonic
1003645443 6:7910317-7910339 GGGGCGCGGGGCCGGGAGCGCGG - Intronic
1003995811 6:11538216-11538238 GGGCGGCGGCGGCGGCTGCGAGG - Intergenic
1004216774 6:13711233-13711255 GGGAGGCGGGGGCGGCGGCGGGG + Exonic
1004216779 6:13711242-13711264 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1005267359 6:24126158-24126180 CGGCGGCGGCGGCGGCTGCGCGG + Intronic
1006148227 6:31971798-31971820 TGGCCGCGGTGGCGTCTGAGGGG - Intronic
1006313280 6:33276424-33276446 TGGCCGCCGTGGCCGCACCGTGG + Exonic
1006340468 6:33443717-33443739 GGGCAGCGGTGGGGGTGGCGGGG + Exonic
1006340509 6:33443888-33443910 GGGCAGCATTGGGGGCAGCGGGG + Exonic
1006950813 6:37819895-37819917 CGGCAGCGGTGGCGGCGGCTGGG - Exonic
1007784207 6:44270790-44270812 CGGCGGCGGTGGCGGCCCCGGGG + Exonic
1007902046 6:45422031-45422053 CCGCCGCGGAGGCGGCGGCGCGG + Intronic
1008617098 6:53237160-53237182 GGGCGGGGGTGGGGTCAGCGGGG - Intergenic
1008946392 6:57101553-57101575 GGGCTGCAATGGAGGCAGCGTGG - Intronic
1009437591 6:63635917-63635939 GGGCGGCGGCGGCTGCAACGAGG + Exonic
1009905638 6:69867378-69867400 CGGCGGCGGTGGCTGCAGGGAGG - Intronic
1010569965 6:77464126-77464148 GGGTGGCGGTGGCGGCGGCGCGG - Intergenic
1010786302 6:80004803-80004825 GGGGCGAGGTGGGGGCAGCTCGG + Intronic
1012400005 6:98835086-98835108 CGGGGGCGGTGGCGGCGGCGGGG + Exonic
1012400018 6:98835107-98835129 GGGGGGCGGGGGCGGCGGCGGGG + Exonic
1013117470 6:107114444-107114466 GGCCCGCGGCGGCGGCGGCCGGG - Intronic
1013836605 6:114342429-114342451 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1014137535 6:117907171-117907193 CGGCGGCGGCGGCGGCAGAGCGG - Intergenic
1014137625 6:117907484-117907506 GGGCGGCGGCGGCGGCGGCACGG + Intergenic
1014246896 6:119078799-119078821 CGGCGGCGGCGGCGGCTGCGCGG - Intronic
1015440371 6:133241040-133241062 GGGGCGGGGTGGGGGCGGCGCGG + Intronic
1016386858 6:143537362-143537384 CGGCCGAGGAGGCGGCAGTGTGG - Intronic
1016713992 6:147203726-147203748 CCGCGGCGGTGGCGGCAGCAGGG - Intergenic
1016882149 6:148921837-148921859 GGGCATGGGTGGCGGCAGTGGGG - Intronic
1017164162 6:151391559-151391581 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1017671968 6:156777703-156777725 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1017872937 6:158502218-158502240 GGGCTGTGGGGGCGGCAGAGGGG - Exonic
1018251584 6:161877230-161877252 GGGCCGCCGTGGCTGGAGTGGGG - Intronic
1018613394 6:165663259-165663281 CGGCGGCGGCGGCGGCGGCGTGG - Intronic
1018778997 6:167045352-167045374 GGGCCGCGGGGGGGGCGGGGAGG - Exonic
1018920400 6:168168353-168168375 CTGCTGCGGTGGCTGCAGCGTGG + Intergenic
1019197620 6:170291369-170291391 GGGCCGCGGCGGCAGCCGAGGGG + Intergenic
1019272637 7:159002-159024 GGGCAGCTGTGGCTGCAGCAGGG + Intergenic
1019298498 7:291162-291184 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1019537834 7:1538250-1538272 GGACGGCGGGGGCGGCGGCGGGG + Intronic
1019562209 7:1664719-1664741 GGGGCGCGGCGCTGGCAGCGGGG + Intergenic
1019606521 7:1912867-1912889 GGCCTGGGGTGGCGGCGGCGAGG + Intronic
1019712102 7:2522467-2522489 TGGCCGCTGTGGTGGCAGCGCGG - Intronic
1019979319 7:4609542-4609564 GGGCCAGGGTGGGGGCAGGGGGG + Intergenic
1020238525 7:6374699-6374721 GGGCCGCGGCGGCGGCGGCAGGG - Exonic
1021101101 7:16586564-16586586 CTGCTGCGGTGGCGGCTGCGTGG + Intergenic
1021451251 7:20785336-20785358 GGGCAGCGGCGGCGGCGGCGGGG - Exonic
1021668645 7:23013558-23013580 GGGCCGAGGCGGCGGCACCCGGG + Intronic
1022036536 7:26539873-26539895 GGGCCACTGTGGAGGCAGCAGGG + Intergenic
1022101918 7:27174003-27174025 GGGCAGCGGTGGCGGTGGCGGGG - Exonic
1022410434 7:30135382-30135404 GGGCGGCGGTGGGCGCAGAGTGG + Intronic
1023064844 7:36367026-36367048 GGGCCTCGGTGGCGGGGGCGCGG + Intronic
1025205981 7:56993667-56993689 GGGCTGCCGTGGGGGCAGCAGGG + Intergenic
1025665959 7:63583272-63583294 GGGCTGCCGTGGGGGCAGCAGGG - Intergenic
1026525048 7:71146221-71146243 GGGCTGCGGTGGTGGCACCCGGG - Intronic
1027051586 7:75024716-75024738 GGGCCCGGGCGGCGGCAGGGAGG - Exonic
1027133130 7:75605460-75605482 GGCCAGCAGTGGCGGCAGCTGGG + Intronic
1029123188 7:98281717-98281739 GGGACGCGGCGGCGGCGGCGGGG - Exonic
1029281563 7:99438956-99438978 CGGCGGCGGCGGCGGCGGCGAGG + Intronic
1029423430 7:100483462-100483484 GGGCCGAGGCTGCGGCTGCGGGG - Intergenic
1029425837 7:100493653-100493675 GGGCAGAGGCAGCGGCAGCGCGG - Exonic
1029456207 7:100673813-100673835 CGGCGGCGGCGGCGGCGGCGCGG - Exonic
1029640539 7:101816757-101816779 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1030138702 7:106284567-106284589 GGCGCGCGGCGGCGGCGGCGCGG - Intronic
1031317496 7:120274634-120274656 TGGCGGCGGGGGTGGCAGCGTGG + Exonic
1032020727 7:128406004-128406026 GGGCTGCGGCAGCGGCAGGGCGG + Intronic
1032074571 7:128830339-128830361 GGGCCGCGGGCGCGGCGGGGGGG + Intergenic
1032119318 7:129144956-129144978 CGGGGGCGGTGGCGGCGGCGGGG + Exonic
1033220505 7:139523987-139524009 GGGCGGCGGGGGCGGGCGCGGGG - Exonic
1033299948 7:140176702-140176724 GGCCGGCGGTGGCGGCTGCGGGG + Intronic
1034192720 7:149224068-149224090 GGGCGGTGGGGGCGGCGGCGCGG + Exonic
1034306280 7:150047662-150047684 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1034336233 7:150325240-150325262 AGGCCGGGGTGACGGCAGGGCGG - Intronic
1034800566 7:154052988-154053010 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1034919690 7:155070120-155070142 GGGGCGAGGTGGCAGCACCGCGG + Intronic
1035169564 7:157010032-157010054 GGGCGGCGGCGGCGGCGGCACGG - Exonic
1035388514 7:158490073-158490095 TGGCCGCGGGAGCAGCAGCGGGG + Intronic
1035579545 8:731407-731429 GGGCTGCGGGGGCGGCGGTGCGG + Intronic
1035670912 8:1416556-1416578 GGGCGGCCGTGGAGGCAGAGGGG - Intergenic
1036664764 8:10731015-10731037 GGGCTGCGGTGGCCGAAGCCCGG - Intronic
1037901764 8:22692952-22692974 TGGCGGCGGCGGCGGCAGCTCGG - Exonic
1038428454 8:27480762-27480784 TGGCAGCGGTGGCAGCAGCAGGG - Intergenic
1038540419 8:28386080-28386102 GGGCCGCGGCCGCTGCAGCCCGG - Intronic
1039476432 8:37841590-37841612 GGGCCGCGGGAGAGGCAGGGGGG - Exonic
1039592104 8:38757510-38757532 GGTTCCCGCTGGCGGCAGCGGGG + Intronic
1040038839 8:42896759-42896781 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1040900633 8:52414068-52414090 GGGGCGCGGCGGAGGCAGCAGGG - Intronic
1041107876 8:54459251-54459273 GGGCCCCGAGGGCGGCCGCGTGG + Exonic
1041689925 8:60678793-60678815 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1041693654 8:60714258-60714280 AGGCCACGGTGCCGGCAGCGAGG - Intronic
1042020677 8:64369770-64369792 GGGTGCCGGTGGGGGCAGCGGGG + Intergenic
1042040117 8:64581033-64581055 AGGAGGCGGCGGCGGCAGCGCGG + Exonic
1042040127 8:64581060-64581082 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
1043388405 8:79768903-79768925 GGGCGGGGGGGGGGGCAGCGGGG - Intergenic
1043847281 8:85177515-85177537 CGGCGGCGGGGGCGGCTGCGGGG - Exonic
1044335973 8:90985229-90985251 TGACCGCGGTGGCGGCGGCGGGG + Exonic
1044675074 8:94720112-94720134 CGGTCGCGGTGGCGGCCGCGCGG + Intronic
1045047549 8:98293973-98293995 GGGCTGCGGTGGCTGCGGGGCGG + Intronic
1045269447 8:100649586-100649608 CGGCAGCGGTGGACGCAGCGCGG + Exonic
1045516292 8:102863625-102863647 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1045847882 8:106658317-106658339 TGGCCGGGGTGGCGGCCGCCGGG + Intronic
1046659968 8:116938488-116938510 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1047381878 8:124372079-124372101 GGGGCGCGGCGGCGGCGGCCGGG + Exonic
1047639159 8:126799761-126799783 GTGGTGGGGTGGCGGCAGCGGGG - Intergenic
1048152119 8:131904206-131904228 GGGCCGCGGAGGCCGGAACGAGG - Exonic
1048214123 8:132480457-132480479 GGGCGGCGGAGGCGGCGGGGCGG - Exonic
1048799390 8:138182084-138182106 GTGCCACTGTGGTGGCAGCGTGG - Intronic
1048999176 8:139813842-139813864 GGGCAGAGGTGACGGCACCGGGG + Intronic
1049145971 8:141001240-141001262 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1049194519 8:141308112-141308134 GGGCCGCGGGGGCGGCGGGGCGG + Intronic
1049426941 8:142541912-142541934 GGGCCGCGGGGGAGACAGCGGGG - Intronic
1049582934 8:143420987-143421009 GGGCCACTGTGGGGGCAGCAGGG - Intronic
1049689786 8:143953447-143953469 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1049746454 8:144265253-144265275 GGGCGGGGGTGGGGGCAGCGTGG - Intronic
1049746960 8:144267086-144267108 AGGCGGCGGGGGCGGCGGCGGGG - Exonic
1049793128 8:144482069-144482091 CGGCGGCGGCGGCGGCAGCCGGG - Intronic
1050437927 9:5629190-5629212 CGGCGGCGGCGGCGGCAGCTCGG - Exonic
1051146207 9:14030209-14030231 GGGGGGGGGTGGCGGCGGCGGGG + Intergenic
1051170273 9:14314170-14314192 GGGCCGGGGTGGGGGCGGGGTGG + Intronic
1051340027 9:16102495-16102517 GGGCGGGGGTGGGGGCAGGGGGG + Intergenic
1053022001 9:34701487-34701509 GGGGCGCGGCTGCGGCAGAGGGG + Intergenic
1053697505 9:40651092-40651114 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054308797 9:63450501-63450523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054820452 9:69516211-69516233 GGGCCCCGCGGGCGGCGGCGAGG - Exonic
1055090981 9:72364787-72364809 GGCCCGCGGCGGCGGCACCAGGG - Intronic
1055091119 9:72365284-72365306 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1055514158 9:77020142-77020164 GGGCGGCGGCGGCGGCGGCTGGG - Exonic
1056475395 9:86947231-86947253 CGGCGGCGGTGGCGGCGGCGAGG - Intergenic
1057441374 9:95086178-95086200 GGGCCGGGGTGGACGCAGGGTGG - Intronic
1057463753 9:95292348-95292370 CGGAGGCGGTGGCGGCGGCGGGG + Intronic
1057547031 9:96026430-96026452 GGGCGGGGGTGGGGGAAGCGCGG + Intergenic
1058504757 9:105656219-105656241 AGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1059123361 9:111661803-111661825 GGGACTCGGTGGCGGCGGCGAGG + Intronic
1059483716 9:114611539-114611561 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1059633936 9:116154342-116154364 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
1060468739 9:123930174-123930196 GGGCAGCGGCGGCGGCAGCGCGG - Intergenic
1061050474 9:128191854-128191876 GGACCGCGGCGGCCGCAGGGAGG - Intronic
1061196659 9:129110566-129110588 CAGCCGCGGCGGCGGCGGCGCGG - Exonic
1061201207 9:129139517-129139539 GAGCCGGGGTGGCTGCAGCAAGG + Intronic
1061726955 9:132587276-132587298 GGGCACCGGCGGCGGCTGCGAGG + Intronic
1061802766 9:133121191-133121213 GCGCGGCGGGGGCGGCGGCGCGG + Intronic
1061959686 9:133981732-133981754 GGCCCGCAGGGGCGGCAGTGGGG - Intronic
1062309414 9:135928123-135928145 GGGCAGGGGTGGCAGCTGCGGGG - Intergenic
1062453835 9:136626629-136626651 GGGCAGGGGTGGGGGCAGGGCGG + Intergenic
1062453848 9:136626652-136626674 GGGCAGGGGTGGGGGCAGGGCGG + Intergenic
1062453861 9:136626675-136626697 GGGCAGGGGTGGGGGCAGGGCGG + Intergenic
1062574565 9:137200220-137200242 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1062578814 9:137220919-137220941 GGGCCGCCGTGGCAGTGGCGGGG + Exonic
1062600485 9:137316772-137316794 AGGCCGCGGTGGGAGCCGCGTGG + Intronic
1062637573 9:137499684-137499706 GGGCAGGGGTGGGGGCAGCGGGG - Intronic
1062659100 9:137619089-137619111 GGGCAGCGGCGGAGGCGGCGCGG + Intronic
1202779853 9_KI270717v1_random:24389-24411 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203471023 Un_GL000220v1:115501-115523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203478844 Un_GL000220v1:159473-159495 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1186496420 X:10015481-10015503 GGGGCGCGGGGGCGGCCGCGGGG - Intergenic
1186867548 X:13735023-13735045 GGGCCGCGGCGGGGCGAGCGAGG + Exonic
1187332643 X:18354706-18354728 GGGCGGCAGTGGCGGTTGCGGGG - Exonic
1187518142 X:19990921-19990943 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1188003525 X:25002645-25002667 GGCCGGCGGCGGCGGCGGCGTGG + Intergenic
1189290047 X:39878383-39878405 GGGCCGCAGTGGCGGGTGGGGGG + Intergenic
1189322789 X:40096705-40096727 AGGCGGCGGTGGCGGCGGCTGGG + Intronic
1190712929 X:53082575-53082597 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1190712969 X:53082701-53082723 GGGAGGCGGCGGGGGCAGCGCGG - Exonic
1191109892 X:56796156-56796178 GGGTTGGGGTGGGGGCAGCGGGG + Intergenic
1192034375 X:67546547-67546569 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1192361761 X:70445135-70445157 TGGCGGCGGTGGCGGCGGCGTGG + Exonic
1195923184 X:110002676-110002698 GCGCCGCGGCGGCGGCCGCCAGG + Intronic
1195954792 X:110317828-110317850 GGGCTGCGGCGGCGGCGGCGGGG - Exonic
1196031077 X:111096314-111096336 GGGCTGCGGCTGCGGCCGCGGGG + Intronic
1198533581 X:137566823-137566845 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
1198534501 X:137573753-137573775 GGGCCGGGGCGGAGGCGGCGAGG + Intronic
1199500598 X:148501616-148501638 GGATGGAGGTGGCGGCAGCGGGG - Intronic
1199698808 X:150362113-150362135 GACCCGCTGTGGCGGCAGCGGGG - Intronic
1200003192 X:153072525-153072547 GCGCCGCTGCGGCGGCGGCGGGG - Exonic
1200004531 X:153077484-153077506 GCGCCGCTGCGGCGGCGGCGGGG + Intergenic
1200047696 X:153411448-153411470 GGGCCGGGGCGGCGGCAGCGTGG - Intergenic
1200089559 X:153627962-153627984 GGGCAGCGAGGGCGGCAGCCAGG + Intergenic
1200100755 X:153688303-153688325 GGGGCGCGCGGGCGGCGGCGGGG - Exonic
1200292665 X:154887048-154887070 GGGCTGGGGTGCCGGCGGCGGGG - Exonic
1200310277 X:155071162-155071184 GGGCGGCGGGGGCGGCAGGGAGG - Exonic
1200339509 X:155382788-155382810 GGGCTGGGGTGCCGGCGGCGGGG - Exonic
1200346961 X:155457905-155457927 GGGCTGGGGTGCCGGCGGCGGGG + Exonic
1201159349 Y:11156128-11156150 GGGCAGCGGTGCTGGGAGCGGGG - Intergenic