ID: 1125053622

View in Genome Browser
Species Human (GRCh38)
Location 15:35331630-35331652
Sequence CAGAGTGAGGAGAATGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 681
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 614}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125053622 Original CRISPR CAGAGTGAGGAGAATGAGAC AGG Intronic
901141499 1:7036095-7036117 GGGAGGGAGGAGAATGAGATGGG + Intronic
901456897 1:9368236-9368258 CAGAGAGAGGGGACTGAAACAGG - Exonic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902618233 1:17635443-17635465 CAGAGGGAGGTGAGTGAGGCAGG - Intronic
902646757 1:17804944-17804966 AAGTGTTAGGAGAATGACACTGG - Intronic
902733550 1:18385411-18385433 GACAGTAAGGAGAAAGAGACTGG + Intergenic
902959639 1:19953918-19953940 TGGAGGGAGGAGCATGAGACTGG + Intergenic
903165597 1:21518204-21518226 AAGAGTGACGAGAAAGAGGCTGG + Intronic
904355660 1:29937445-29937467 AAGAGCTAGGAGAAGGAGACTGG + Intergenic
904677072 1:32205272-32205294 CAGTTTGAAGAGAATGAGAGGGG - Exonic
904784930 1:32975739-32975761 CTGAGGCAGGAGAATCAGACCGG + Intergenic
905267580 1:36765276-36765298 CACAGTGAGGAGAAGCAGAGGGG - Intergenic
905599317 1:39235394-39235416 CTGAGTCAGGAGAATCAGGCAGG + Intronic
905741045 1:40372201-40372223 CAGAGTGAGGAGATGAAGATGGG + Intronic
905850991 1:41274818-41274840 CAGGGTGAGGAGAAAGAGAGGGG - Intergenic
906302015 1:44689650-44689672 CAGAGGGAGGGAAAAGAGACAGG - Intronic
906341025 1:44980932-44980954 CAGCGTTATGAGAATGAGAGAGG - Intronic
906748993 1:48242158-48242180 CAGACTGAGGCAAATGAGGCTGG - Intronic
907345641 1:53777129-53777151 AATAGTGAGGAGGCTGAGACAGG - Intronic
907574292 1:55512117-55512139 CAAAGTTTGGAGAATGAAACAGG + Intergenic
907575021 1:55518644-55518666 CAGAGGGAGGAAGGTGAGACAGG + Intergenic
907814863 1:57908547-57908569 CTGAGTGAAGAGACTGACACAGG + Intronic
908803225 1:67902260-67902282 CAGATGTAGGAGAATGAAACTGG - Intergenic
909087065 1:71180764-71180786 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
910042417 1:82868662-82868684 GAGAGTGAGGAGAGTGAGGAAGG + Intergenic
911368657 1:96970986-96971008 CAGAGAGAGGAGAATGGGAGAGG - Intergenic
912647279 1:111405442-111405464 AAGAGTGTGGAGAGTGAGATGGG + Intergenic
912864533 1:113245602-113245624 CAGAATGTGGAGAAAGAGAGAGG - Intergenic
912976559 1:114336253-114336275 CAGAGAGAGGGGAACAAGACTGG + Intergenic
913093611 1:115496452-115496474 CAGAGCCAGGAGCATCAGACTGG - Intergenic
913388694 1:118286963-118286985 CTGAGGCAGGAGAATGAGCCCGG + Intergenic
913489395 1:119364768-119364790 CAGAGAGAGCAGGGTGAGACTGG + Intergenic
913567373 1:120086095-120086117 CAGAGAGATGAGGATGGGACAGG + Intergenic
913630763 1:120707451-120707473 CAGAGAGATGAGGATGGGACAGG - Intergenic
914664174 1:149819165-149819187 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
914671588 1:149874677-149874699 CTGAGGCAGGAGAATGAGGCAGG + Intronic
914893990 1:151652090-151652112 CTGAGTCAGGAGAATCAGGCAGG + Intronic
915506257 1:156358260-156358282 CAGATAGAGGTCAATGAGACAGG + Intronic
916660125 1:166915838-166915860 CACAGTGAGGATCATGAGAAGGG + Exonic
916993493 1:170270112-170270134 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
917002291 1:170373551-170373573 CAAAGGGAGGATAATGAGGCTGG + Intergenic
917516622 1:175713965-175713987 GGGAGAGAGGAGAGTGAGACAGG - Intronic
917790460 1:178495953-178495975 CCAGGAGAGGAGAATGAGACTGG + Intergenic
918022871 1:180711513-180711535 CTGAGGCAGGAGAATGAGGCAGG + Intronic
918253548 1:182726349-182726371 CAGAGCATGGAGATTGAGACTGG - Intergenic
919269447 1:195320298-195320320 CAGAGTGGGGAGAATGTGATTGG - Intergenic
919564163 1:199162661-199162683 CAGAGTGTGCAGGAAGAGACAGG - Intergenic
920928146 1:210362354-210362376 CATGGTCAGGAGAATGAGGCAGG - Intronic
920997350 1:211007723-211007745 CAGAGGTAGGAAAATGACACTGG - Intronic
921023451 1:211257607-211257629 CAGAGTGAGGAGCATTTGACAGG + Intergenic
921546952 1:216484407-216484429 CTGAGGGAGGAAAATGAGATAGG + Intergenic
922334154 1:224605504-224605526 CCAAGTTAGGAGAATGAGAGAGG + Intronic
922573103 1:226645282-226645304 CAGAGGGAAGAGGATGAGAGAGG - Intronic
922790259 1:228307288-228307310 CAGAGTCTGGAGCAGGAGACAGG + Exonic
923040703 1:230318062-230318084 CAGAGCTAGGAGAATGTGCCTGG + Intergenic
923793178 1:237128273-237128295 CTGAGTCAGGAGAATCAGGCAGG + Intronic
924733889 1:246737368-246737390 CCTACTCAGGAGAATGAGACAGG + Intronic
924851848 1:247838902-247838924 AAGAGTGAGGAGAACAAGAGTGG - Intergenic
1063098165 10:2926541-2926563 CAGAGTTAGGTGGATGAAACAGG + Intergenic
1063135164 10:3209841-3209863 CAGAGAGAGGAGACAGAGAGAGG - Intergenic
1063176538 10:3555637-3555659 CAGAGTGTGGAAAATGCTACAGG - Intergenic
1063486586 10:6425993-6426015 CAGAGTGAGGAGAGGACGACTGG + Intergenic
1064490824 10:15854620-15854642 GAGAGTGAGAGGAATGAGAAGGG + Intronic
1064565555 10:16635622-16635644 CAGAGTGGGGACAATGAGGTAGG - Intronic
1064697018 10:17976895-17976917 CAGAGAAAGGAGAAAGAGAAAGG - Intronic
1065577251 10:27134085-27134107 CAGAACGAAGAGAATCAGACGGG + Exonic
1065996565 10:31064693-31064715 CAGAGAGTGGAGAATCAGGCTGG + Intergenic
1067694513 10:48524811-48524833 AAAAGTGAGGAAAATGATACCGG + Intronic
1068716158 10:60191029-60191051 CAGATGAAGGAGAATGAAACTGG + Intronic
1069421396 10:68249801-68249823 CTGAGTGAGGAGCATGGGAGAGG - Intergenic
1069850239 10:71399433-71399455 CACAGAGATGAGAATGAGATTGG + Intronic
1070150276 10:73800986-73801008 CAGGGGGAGGGGCATGAGACGGG - Intronic
1071294178 10:84207250-84207272 GAGAGTGAGGAGGAGGAGAGGGG + Intronic
1071305403 10:84294939-84294961 CAGAGTGTGGTCAATGAGAGAGG + Intergenic
1071393711 10:85200645-85200667 CAGAGTGATGATAATGATAATGG - Intergenic
1071433909 10:85628835-85628857 CAGAGTGAATAGAATGGGAGTGG + Intronic
1071491463 10:86139387-86139409 CAGAGGGAGGTGAAGGGGACTGG - Intronic
1071743459 10:88388454-88388476 CAGAGTGAGGCAAATTAAACTGG - Intronic
1072309559 10:94141465-94141487 GAGAGGGAGGAGAAGGAGAAGGG + Intronic
1073679643 10:105688799-105688821 CAGAGTGGGGAGGAAGAGAGGGG - Intergenic
1073684121 10:105733929-105733951 GACAGTGGGGAGACTGAGACAGG + Intergenic
1074496702 10:113985924-113985946 CAGAGGCAGGAGAGAGAGACAGG + Intergenic
1075575853 10:123576972-123576994 CAGAGTGAACAGAATGAGAGGGG + Intergenic
1075747236 10:124736435-124736457 CTGGGTGAGGAGAAGGAGCCTGG - Intronic
1076306384 10:129468095-129468117 CAGAGAGCTGAGAATTAGACTGG + Intronic
1076581709 10:131516530-131516552 CAGAGTGAGGAGAGAGGGATAGG - Intergenic
1077068207 11:654278-654300 CAGACTCAGGAGGCTGAGACAGG - Intronic
1077103569 11:832621-832643 CTGGGTGAGGAGAAAGAGATGGG + Intergenic
1077836926 11:5934113-5934135 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1078263288 11:9732431-9732453 CAGTGGGAAGAAAATGAGACAGG - Intronic
1078367067 11:10715597-10715619 CAGGGTGTGGAGATGGAGACTGG - Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078861447 11:15251046-15251068 GAGAGGTATGAGAATGAGACAGG - Intergenic
1079314139 11:19393253-19393275 CAGCATGAGAAGAATGAAACTGG - Intronic
1079453796 11:20619876-20619898 CTGAGTGAGTACCATGAGACTGG + Intronic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1080672122 11:34390207-34390229 CACAGGTAGGAGAATGAAACTGG - Intergenic
1081529041 11:43945335-43945357 GAGAGAGAAGAGAATGAGGCTGG - Intergenic
1081683761 11:45027101-45027123 GAGAGGGAGGAGAGGGAGACAGG - Intergenic
1081829332 11:46094099-46094121 CAAAGTGATGAGGATGGGACTGG + Intronic
1083105024 11:60349006-60349028 CAGAGTGAAGAGAATGGGGTGGG + Intronic
1083114831 11:60450792-60450814 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1083118749 11:60491024-60491046 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1083154446 11:60814577-60814599 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1083369336 11:62165974-62165996 CAGATTGAGGAGAGTGACTCGGG + Intergenic
1083803077 11:65057939-65057961 CGGACTGAGGAGAACGTGACCGG - Exonic
1083874799 11:65516319-65516341 CAGAGAGAGGAGAGAGAGAAAGG + Intergenic
1084582272 11:70031595-70031617 CAGAGTGGGGACCAAGAGACTGG + Intergenic
1084999837 11:73021980-73022002 GAGGGAGAGGAGAATGAGATGGG + Intronic
1085094960 11:73753002-73753024 CAGAGTCAGGAGCTTGAGGCGGG + Intronic
1085822062 11:79804110-79804132 CTGAGGCAGGAGAATCAGACAGG - Intergenic
1086513501 11:87586359-87586381 CATAGGTAGGAGAATGAAACTGG - Intergenic
1086693520 11:89816832-89816854 TAGAGTGACAAGAATGAGAGTGG - Intergenic
1086712629 11:90027737-90027759 TAGAGTGACAAGAATGAGAGTGG + Intergenic
1087850696 11:103024990-103025012 AAGAATGAGAAGAATGAGATGGG + Intergenic
1088236799 11:107733493-107733515 GAGAGGGATGAGAAAGAGACAGG - Intergenic
1088549332 11:110995389-110995411 CTGAGGTATGAGAATGAGACTGG - Intergenic
1088805718 11:113350331-113350353 CAGAGTGACTAGAATGGGAGTGG - Intronic
1089360972 11:117886207-117886229 CAGAGTGGGCAAAATGAGCCAGG + Intergenic
1089600253 11:119609861-119609883 TAGAGTGAGGTGAATGAGACGGG + Intergenic
1089730561 11:120516339-120516361 CACAGTGAGGAGGCTGAGAAGGG + Intronic
1089874632 11:121708150-121708172 CAGAGAGAGGAGATGGAGTCAGG - Intergenic
1089947617 11:122493910-122493932 CATGGTGAGGAGAACGTGACGGG - Intergenic
1090480242 11:127061491-127061513 GAGGGTGAGGAGAATGGGACAGG - Intergenic
1090993706 11:131844950-131844972 CAGAGTCAGCATAGTGAGACAGG - Intronic
1091294090 11:134460357-134460379 GAGAGTGATGAGAATGAGCCGGG - Intergenic
1091964025 12:4722862-4722884 AAGAGCGAGGAGAGTGAGAAGGG + Intronic
1091966279 12:4745071-4745093 GAGAATGTGGAGAATCAGACAGG + Intronic
1092847359 12:12596160-12596182 CTGAGTGAAGAGAATGAGTTAGG + Intergenic
1092902114 12:13069724-13069746 CAGAGAGATGAGAATGAGGTCGG + Intronic
1094686812 12:32725445-32725467 CACAGTGAGGTGAATAAAACAGG - Intronic
1096115824 12:49054505-49054527 GTGAGTGAGGAGAATGGGGCAGG - Intronic
1097285515 12:57874066-57874088 GGGAGTGGGGAGAATGAAACAGG + Intergenic
1098145859 12:67497410-67497432 GAGAGTCAGGAGAGTGAAACAGG + Intergenic
1098430135 12:70410046-70410068 CCAGGTGAGGAGAAAGAGACAGG - Intronic
1098774030 12:74588832-74588854 CTGAGGGAGGAGAATCAGGCAGG + Intergenic
1098894918 12:76047797-76047819 CACAGTGAGGTGAATAAAACGGG - Exonic
1099494790 12:83333986-83334008 CATAGTGAGGAACATTAGACAGG + Intergenic
1099598723 12:84703218-84703240 CTGAGTCAGGAGGCTGAGACAGG - Intergenic
1101195988 12:102382999-102383021 CACAGGTAGGAGAATGAAACTGG - Intergenic
1101315940 12:103628943-103628965 TAGGGTGAGGAGAGTGAAACAGG - Intronic
1101399939 12:104378350-104378372 CAGGGTGAGGAAGATGACACAGG - Intergenic
1101758223 12:107638282-107638304 CTGAGTGAAGAGAATCAGTCTGG + Intronic
1104301430 12:127568575-127568597 GAGAGAGAGGAGAAGGAGAGAGG + Intergenic
1104301443 12:127568676-127568698 GAGAGAGAGGAGAAAGAGAGAGG + Intergenic
1104908839 12:132229916-132229938 CAGAGTGAGGTGGCTGAGATTGG - Intronic
1105527235 13:21187302-21187324 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
1106333018 13:28756503-28756525 TGGAGAGAGGAGAATGAGCCTGG + Intergenic
1106602902 13:31202322-31202344 CAGAATGAGAAGATTGAGTCAGG + Intronic
1106883346 13:34156192-34156214 CAGAGCTAGAAGAAAGAGACCGG - Intergenic
1107600396 13:42006639-42006661 GAGAGTGTGGAGGGTGAGACAGG - Intergenic
1107861005 13:44660823-44660845 GGGAGGGAGGAGAATGAGGCGGG + Intergenic
1108036640 13:46297023-46297045 CAGCGTGTGGAGGATGAGCCTGG - Intergenic
1108147473 13:47494754-47494776 CTGTGTGAGGAGAATGAAACAGG + Intergenic
1111609381 13:90583580-90583602 CAGCCTGAGGAGATTAAGACAGG + Intergenic
1111659230 13:91188830-91188852 CAGAGGGAGGATAAAGAGAATGG + Intergenic
1111788742 13:92825699-92825721 TATAGTGAGGAGAATCAGAATGG - Intronic
1112492873 13:99883048-99883070 CAGAGTGAAGAAAAGGAAACAGG + Intronic
1113845127 13:113383402-113383424 CACAAGGAGGAGAATGAAACTGG - Intergenic
1114029444 14:18563838-18563860 CAGAAAGAAGAGAATCAGACAGG - Intergenic
1114255758 14:21000195-21000217 GAGAGTGAGGAGAACCAGAGAGG + Intronic
1114439017 14:22731295-22731317 CAGGCTGAGGAGAGTGTGACAGG - Intergenic
1114572924 14:23687172-23687194 CAGAGAGAGGAGAATGGATCTGG + Intergenic
1114873865 14:26691082-26691104 GAGAGGGAGGAGAAGGACACAGG - Intergenic
1115204590 14:30888268-30888290 GAGAGTCAGGAAAAGGAGACTGG + Intronic
1115494044 14:33984987-33985009 CTGAGGCAGGAGAATCAGACAGG + Intronic
1115547306 14:34475558-34475580 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1115695501 14:35893586-35893608 CATACTGAGAAGAATGAAACTGG - Intronic
1116652491 14:47611152-47611174 CACAGGTAGGAGAATGAAACTGG + Intronic
1117116083 14:52514001-52514023 CAAAATCAGCAGAATGAGACAGG + Intronic
1118139423 14:63064324-63064346 GAGAGTGAGAAGAAAGAGAAGGG + Intronic
1118162717 14:63306731-63306753 CAAATGTAGGAGAATGAGACTGG + Intergenic
1118318519 14:64739845-64739867 CAGTGTGATGGGAATGAGAGGGG - Intronic
1119254744 14:73185494-73185516 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1120502200 14:85310696-85310718 GAGAGAGAGGAGAGTGAGGCAGG + Intergenic
1122160358 14:99779867-99779889 CACAGTGAGAGGAAGGAGACGGG + Intronic
1122212150 14:100180385-100180407 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1122238058 14:100344179-100344201 CTGAGGCAGGAGAATGAGGCAGG - Intronic
1122501130 14:102200396-102200418 CACAGTGAGCTGAATGTGACCGG - Intronic
1122802885 14:104240510-104240532 CAGGGGGAGGGGAATGAGGCTGG - Intergenic
1123703223 15:22931309-22931331 GTGAGTGAGGAGAATGGGAGTGG + Intronic
1123987077 15:25655425-25655447 GAGAGTGAGAAGAATAAGTCAGG - Intergenic
1125053622 15:35331630-35331652 CAGAGTGAGGAGAATGAGACAGG + Intronic
1125362843 15:38882252-38882274 AAGAGGTAGGAGATTGAGACTGG - Intergenic
1125459819 15:39895119-39895141 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125870919 15:43101140-43101162 ATGAGTGAGGAGAATGTAACAGG + Intronic
1127375746 15:58382870-58382892 TAGAGGGAGGGGAATGAGATGGG - Intronic
1127525196 15:59786025-59786047 CACATGGAGGAGAATGAAACTGG + Intergenic
1127720880 15:61698121-61698143 CAAAATGAAGAAAATGAGACTGG + Intergenic
1128146417 15:65334648-65334670 CTGGGTGAGGAGTCTGAGACCGG + Intronic
1128775736 15:70318706-70318728 AAGAGGGAGGAGAATAGGACTGG + Intergenic
1129445844 15:75617302-75617324 TAAAGAGAGGAGAATGAGGCAGG - Intronic
1129802841 15:78429270-78429292 AACAGTGAGGAGGATGAGACCGG - Intergenic
1130181648 15:81635349-81635371 CACAGTGATCTGAATGAGACTGG - Intergenic
1130428522 15:83823095-83823117 CTGAGGCAGGAGAATGAGGCAGG + Intronic
1130540777 15:84819467-84819489 CAAAGTGGGGAGAATGTGACTGG + Intronic
1131278620 15:91003134-91003156 AAGAGTGAAGAAAATAAGACAGG + Intronic
1131682259 15:94736531-94736553 CACAGTGAGAAGGAAGAGACAGG + Intergenic
1132302589 15:100785321-100785343 CAGAGTGAGGAGGAAGGGAAGGG + Intergenic
1133048799 16:3104991-3105013 TAGAGTGAGAAGAATGTGATAGG + Intergenic
1133873825 16:9714272-9714294 CAGAGTGGGGAGAGGGAGATTGG - Intergenic
1135800928 16:25494572-25494594 CTTAGTGATGAGAATGAGGCAGG + Intergenic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1136155035 16:28376825-28376847 CTGAGACAGGAGAATGAGGCAGG - Intergenic
1136165026 16:28448056-28448078 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1136197939 16:28666924-28666946 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136208057 16:28738437-28738459 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136214286 16:28781101-28781123 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136259006 16:29060946-29060968 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136870190 16:33799974-33799996 CACAGAGAGTAGAATGAGGCTGG + Intergenic
1137268475 16:46886929-46886951 CAGTGAGAAGAGAATGAGAAGGG - Intronic
1137368566 16:47883086-47883108 CACAGTGACCTGAATGAGACTGG + Intergenic
1137438484 16:48478208-48478230 CTGAGTCAGGAGTTTGAGACCGG + Intergenic
1137493331 16:48951203-48951225 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1137539173 16:49350217-49350239 TGGAGAGAGGAGAAAGAGACAGG - Intergenic
1138652804 16:58471404-58471426 CAGAGTGATCAGAACGAGGCTGG - Intronic
1138809721 16:60134836-60134858 CATACGCAGGAGAATGAGACTGG - Intergenic
1138812110 16:60163488-60163510 AAGAGAGAGGAGAAAGAGAGAGG + Intergenic
1139127956 16:64104231-64104253 CAGAATGGGTAGAATGGGACAGG - Intergenic
1139402481 16:66694041-66694063 AAGAGTGAGAAGAAAGAGAGAGG + Intronic
1141305629 16:82860908-82860930 GAGAGAGGGGAGAGTGAGACTGG - Intronic
1141362405 16:83408122-83408144 ATGTGTCAGGAGAATGAGACCGG - Intronic
1141818930 16:86431945-86431967 CCGAGAGAGGAGCATGAGTCAGG - Intergenic
1142332175 16:89462176-89462198 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1203101981 16_KI270728v1_random:1316080-1316102 CACAGAGAGTAGAATGAGGCTGG - Intergenic
1142533456 17:598068-598090 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1142658987 17:1414595-1414617 GAGAGTGAGGAAGATGAGGCTGG + Intergenic
1143069778 17:4281385-4281407 CAGAGTTAGGAATATGAGAAAGG + Intronic
1143132104 17:4685347-4685369 CTGACTAAGGAGACTGAGACAGG - Intronic
1143391289 17:6560774-6560796 GAGAAGGAGGAGAATGAGAAAGG - Intergenic
1143689503 17:8549795-8549817 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1143784782 17:9248105-9248127 CAGAGTTAGAAGAATGAAACGGG - Intergenic
1144152879 17:12467513-12467535 GAGAATGATGAGAATGAGAAGGG + Intergenic
1144616516 17:16780050-16780072 CACATTTAGGAGAATGAAACTGG + Intronic
1144896180 17:18535609-18535631 CACATTTAGGAGAATGAAACTGG - Intergenic
1145136033 17:20408611-20408633 CACATTTAGGAGAATGAAACTGG + Intergenic
1145920408 17:28605154-28605176 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1146061233 17:29608416-29608438 CAGAGTGAAGAGAATAATAATGG - Intronic
1146735955 17:35239459-35239481 CAGACTGAGGACAGTGACACAGG + Intergenic
1147050401 17:37790078-37790100 GGGAGTGGGGAGAAAGAGACAGG + Intergenic
1147339919 17:39747121-39747143 CAGAGCTAGGAGAAGGAGAGGGG - Exonic
1147500095 17:40954830-40954852 GAGAGTGAGGAGCAGAAGACGGG + Intergenic
1147548397 17:41420845-41420867 CCGAGTTAGGAGATTGAGGCTGG - Exonic
1148262006 17:46192760-46192782 GAGAGCGAGGAGAAGGAGAAAGG + Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148807764 17:50272852-50272874 CAGAGAGAGGAGAAACAGACGGG + Intronic
1149681663 17:58511923-58511945 CAGAGCTAGGAAAATGAGGCAGG + Intronic
1150124692 17:62628321-62628343 CAGAGCGAGGAGACTGGGCCCGG - Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1151467481 17:74296758-74296780 AAGAGGGAGCAGAATGAGGCTGG - Intronic
1151479737 17:74362921-74362943 CAGAGAGAGGAAAGTGAGTCTGG + Intergenic
1152128989 17:78465037-78465059 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1152985254 18:315176-315198 GAGAATGAAGAGAATGAGTCTGG + Intergenic
1153102711 18:1492182-1492204 CATAGGGAGAAGAATGAAACTGG - Intergenic
1153633910 18:7097956-7097978 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1153769721 18:8405555-8405577 TCCAGTGAGGAGGATGAGACAGG - Intronic
1153788766 18:8558334-8558356 CAGATTCAGGAGAATCAGCCAGG - Intergenic
1154404222 18:14073669-14073691 CAGAGTGAAGATCATGATACAGG - Intronic
1155074451 18:22342382-22342404 CAGAGAGAGGAGAAGCAGAGAGG + Intergenic
1155729269 18:29132171-29132193 CAGAGTCAAGAGAATGAGTGAGG - Intergenic
1156145743 18:34175162-34175184 CAGAGAAAGGAGAATGGAACTGG + Intronic
1156504506 18:37580805-37580827 CAGTGTAAGGAGAATGAGAAAGG - Intergenic
1158182346 18:54730660-54730682 GAGAGTGAGGAGGAGGAGTCAGG - Intronic
1158338531 18:56439733-56439755 CACATGGAGGAGAATGAAACTGG + Intergenic
1158726184 18:59974979-59975001 CAGAGTCAGTAGAAAGAGAAAGG + Intergenic
1159029834 18:63219566-63219588 CTGCGTGAGGAGGCTGAGACAGG - Intronic
1159340602 18:67127565-67127587 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
1159597824 18:70400044-70400066 CACAGAGAGGAGAATGCCACAGG + Intergenic
1159893036 18:73970851-73970873 TACAGTTAGGAGAATGAGAAAGG - Intergenic
1160531419 18:79567177-79567199 CAGAGGGACGAGGATGAGGCCGG - Intergenic
1160940515 19:1618519-1618541 CAGAGTGAGGAGAGGGAGAGAGG - Intronic
1161226155 19:3146909-3146931 CAGAGTGAGGAGGGGGAGAGAGG - Intronic
1161243056 19:3233664-3233686 CAGAGTGAGGAGGGGGAGAGAGG + Intronic
1161253093 19:3291736-3291758 CAGAGTGAGGAGGGGGAGAGAGG + Intronic
1161257301 19:3316494-3316516 CAGAGTGAGGAGGGGGAGAAAGG + Intergenic
1161257916 19:3320147-3320169 CAGAGTGAGGAGGGAGAGAGAGG + Intergenic
1161270307 19:3386000-3386022 CAGAATGAGGAGGATGGGCCGGG - Intronic
1161274907 19:3410518-3410540 CAGAGTGAGGAAGGGGAGACAGG + Intronic
1161416792 19:4151752-4151774 CAGAGTGAGGAGAGGAAGACAGG - Intergenic
1161442604 19:4300812-4300834 CAGAGTGAGGACAGGGAGAGAGG + Intronic
1161501447 19:4618284-4618306 GAGAGAGAGAAGAATGAGAAAGG - Intergenic
1161642947 19:5435706-5435728 CAGAGTGAGGAGGGGGAGAGAGG - Intergenic
1162268773 19:9597184-9597206 CTGAATGAGCAGAATGAGTCAGG + Intergenic
1162602276 19:11677775-11677797 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1163648066 19:18501561-18501583 CAGAGCCAGGCGGATGAGACGGG + Intronic
1163995346 19:21040452-21040474 AAGTGTGAGGTGAAGGAGACAGG - Intronic
1164231343 19:23290707-23290729 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1165757232 19:38300999-38301021 CAGAGAGAGCAGAAGGAGAGAGG - Intronic
1166389780 19:42402485-42402507 CGGAGTGGGGAGAAAGGGACAGG - Intronic
1167038648 19:47009226-47009248 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1167129241 19:47573382-47573404 GAGAGTGAGAAGAGTGAGCCGGG + Intergenic
1168535748 19:57168022-57168044 AAGAGTGAGGCTAGTGAGACAGG + Intergenic
924998040 2:382036-382058 CAAAGTGTGGAGAATTAGCCCGG + Intergenic
925326927 2:3030084-3030106 CAGAGGGAGAAGAAAGAGGCAGG + Intergenic
925789828 2:7472698-7472720 CCGAGGGAGTAGAATGAGGCTGG + Intergenic
926172036 2:10558606-10558628 CAGTGTGAGGAAACTGAGGCAGG + Intergenic
926215697 2:10903756-10903778 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
927049805 2:19316184-19316206 CAGAGGGAGGAGGGTGAGAGGGG - Intergenic
927372330 2:22370871-22370893 CAGAGTGAGGAGGTAGAGAGTGG + Intergenic
929052108 2:37846412-37846434 CAGAGAGAGGAGAAAGAGAGAGG - Intergenic
929110514 2:38402792-38402814 CTGAGTTAGGAGAATCAGGCAGG - Intergenic
929122627 2:38495997-38496019 GAGAGTGAGGGGCATGAGACAGG + Intergenic
929466707 2:42151584-42151606 TAGAGTGACAAGAATGAAACAGG - Intergenic
929518046 2:42622305-42622327 CTGAGGCAGGAGAATCAGACAGG + Intronic
929760749 2:44804342-44804364 CAGAGCGAGGAGATTTAGGCTGG - Intergenic
930044137 2:47154382-47154404 CAGAATAAGGAAAATGAGATGGG + Intronic
930882643 2:56289507-56289529 CAGAGGGAGCAGCATGAGAGAGG + Intronic
931576251 2:63721836-63721858 CTGAGTCAGGAGAATCAGGCAGG - Intronic
933155588 2:78969558-78969580 CAGATTGATGGGAATGAGAGTGG + Intergenic
933943982 2:87268373-87268395 CTGAGTCTGGAGAATGGGACTGG + Intergenic
934742524 2:96735492-96735514 CAGAGTGACAAGACAGAGACTGG - Intronic
935104350 2:100025843-100025865 CAGATGTAGGAGAATGAAACTGG + Intronic
935898253 2:107761058-107761080 CAGACCGAGGAGACTCAGACAGG + Intergenic
936336238 2:111593206-111593228 CTGAGTCTGGAGAATGGGACTGG - Intergenic
936485216 2:112919481-112919503 CAGAGTGAGGGGGTGGAGACAGG + Intergenic
936485460 2:112921678-112921700 TAGAGTGAGAAAAATAAGACAGG - Intergenic
937279285 2:120706219-120706241 CAGAGTGTGGGGATTGAGAGGGG - Intergenic
937639345 2:124193851-124193873 GAGAGGGAGGAGACAGAGACAGG + Intronic
937681767 2:124651977-124651999 CAGAGGGAGAAGGAAGAGACAGG + Intronic
937751812 2:125484728-125484750 CCTAGTGAGGACAATCAGACAGG - Intergenic
937843921 2:126556209-126556231 CAGGGTGGGGAGGAAGAGACGGG + Intergenic
938003449 2:127766879-127766901 CTGAGAGAGGAGGCTGAGACAGG - Intronic
938229519 2:129646418-129646440 AAGAATGAGGGGCATGAGACTGG + Intergenic
938417485 2:131115993-131116015 CAGAATGAGGAGAGGTAGACAGG + Intronic
938663011 2:133506519-133506541 CAGTGTGAGGAGAATGAAGTGGG + Intronic
938719818 2:134056669-134056691 CAGAGGAAGGAGAAAAAGACAGG + Intergenic
938999388 2:136716387-136716409 TAGAGTGAGGAGGATGAGGAGGG + Intergenic
939855385 2:147352758-147352780 CAGAGAGAGAAGAATGAGGAAGG + Intergenic
939926499 2:148180819-148180841 CAAGGGCAGGAGAATGAGACTGG - Intronic
940298989 2:152159825-152159847 CTGAGGCAGGAGAATGAGGCAGG - Intronic
940635434 2:156292969-156292991 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
940679666 2:156770158-156770180 GAAAGTGAGGAGAAAGAGACAGG + Intergenic
941013370 2:160326563-160326585 CAGAGAGAACAGAATGAGACTGG + Intronic
941520747 2:166539039-166539061 CAGATTTAGAAGAATGAAACAGG - Intergenic
941693144 2:168522642-168522664 CAGTGGGAGGGGAATGAAACTGG - Intronic
942261407 2:174168204-174168226 CAAAGGGAAGAGAAAGAGACAGG + Intronic
942621186 2:177845919-177845941 CTGAGGCAGGAGAATCAGACAGG + Intronic
942780443 2:179635350-179635372 CAGAGTGAGGAACATCACACTGG + Intronic
943480228 2:188408105-188408127 CAGGGTGAGGCCAATGAGATGGG + Intronic
943854897 2:192777064-192777086 AAGTATGAGGAGAATGAGATGGG - Intergenic
944141327 2:196460003-196460025 GAGGGTGAGAAGAATAAGACAGG - Intronic
944382840 2:199131564-199131586 GAGATTGAGGAGATTGAGAGAGG - Intergenic
944856773 2:203775608-203775630 CAGAGTGAGGAGGGTGAGATTGG + Intergenic
944992389 2:205253238-205253260 AAGAGTGAGAAGATAGAGACAGG + Intronic
945857896 2:215090354-215090376 CAGAGTGAGGACAAGGACAGGGG - Intronic
946415379 2:219537474-219537496 CAGAGTCAGGAGAAGGGGATGGG + Intronic
946534858 2:220615924-220615946 CTGTATGAGGGGAATGAGACTGG - Intergenic
946550573 2:220797375-220797397 AGGAGTGAGCAGAATGTGACTGG - Intergenic
946845992 2:223859512-223859534 CAAAGAGAAAAGAATGAGACTGG - Intronic
947249662 2:228087839-228087861 GAGAGAGAGGAGAAAGAGAGAGG + Intronic
947692933 2:232156141-232156163 AAAAGTGAGGAAAATGAAACTGG - Intronic
947808202 2:232982840-232982862 CAAAGTGGGGAGAGTGAGACAGG + Intronic
947847213 2:233254301-233254323 AAGAGGCAGGAGAGTGAGACAGG + Intronic
947861954 2:233366747-233366769 GAGAGTGAGGACAGTGTGACGGG + Intronic
948459123 2:238120683-238120705 CAGAGGGAGAAGACGGAGACAGG - Intronic
948606778 2:239140929-239140951 CACAGTGAGGAGGATGAGGAGGG + Intronic
1169431432 20:5539742-5539764 CAAGGTTAGGAGAATGAGAAGGG + Intergenic
1169779624 20:9295007-9295029 CAGAGTGGGGACTATGAGAATGG - Intronic
1170091762 20:12596859-12596881 AAGAGTGAAGAGATAGAGACAGG - Intergenic
1170745752 20:19097583-19097605 CAGAGTGAGAAGAGGGAGAGGGG + Intergenic
1171977929 20:31607113-31607135 CAGAGTGAGGAGGCCGAGTCTGG - Intergenic
1172624406 20:36338969-36338991 CAGAGGGAGGAGGCTGAGAGGGG + Intronic
1172728732 20:37068945-37068967 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1173125041 20:40328764-40328786 CAGTGTGAGGAGCATAAGCCTGG - Intergenic
1174117534 20:48237605-48237627 CACAGTGAGAAGAATGAAGCTGG + Intergenic
1174861704 20:54097518-54097540 AAGAGAGAGGAGAATGAGAAAGG - Intergenic
1174961950 20:55167578-55167600 CAGAGAGAGGAGGAGGAGATAGG + Intergenic
1177285991 21:19050411-19050433 CAGGGTGTGGAGAATGAGTGTGG + Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1178051084 21:28748108-28748130 TAGAGTGAGGAGAGAGGGACAGG + Intergenic
1178299985 21:31444578-31444600 CAGCTTGAGGGAAATGAGACTGG + Intronic
1178408069 21:32341153-32341175 CAGAGGGATGAGAAAGAAACAGG + Intronic
1178434518 21:32546202-32546224 AAGAGTGAGGGGAAACAGACAGG - Intergenic
1178728939 21:35081182-35081204 CAGAGTTAGGATAATGAGAGGGG + Intronic
1179356875 21:40668031-40668053 CAGAGTTAATAGAATGAGACTGG - Intronic
1179969514 21:44826424-44826446 TAGATGGAGGAGAAGGAGACAGG + Intergenic
1180453559 22:15490888-15490910 CAGAAAGAAGAGAATCAGACAGG - Intergenic
1180604666 22:17048421-17048443 GAATTTGAGGAGAATGAGACTGG + Intergenic
1182056259 22:27357650-27357672 CAGCCTGAGCAGAATAAGACAGG + Intergenic
1182258060 22:29052234-29052256 CGAAGAGAGGAAAATGAGACTGG - Intronic
1182348830 22:29686897-29686919 CCGAGTGAGGGGAGTGAGTCTGG + Intronic
1183035537 22:35138387-35138409 CAGGGAGAGGAGAATGTGAGGGG + Intergenic
1183217482 22:36490279-36490301 CAAAATGAGGAGAATGAGCCAGG + Intronic
1183690817 22:39387431-39387453 GAGAGAGAGGAGAATGAGGAAGG + Intergenic
1184264450 22:43339659-43339681 TAGAGTGAGGAGAATGGGGGAGG - Intronic
1184355775 22:43978692-43978714 AGGAGTGAGGAGAAAGTGACTGG + Intronic
1184679977 22:46065888-46065910 CATAGTCAGGAAAATGAAACTGG + Intronic
949372054 3:3346065-3346087 TAGACTGTGGAGAATGAGAAAGG + Intergenic
950108322 3:10402372-10402394 CAGAGTGAGGTCAACCAGACAGG + Intronic
951016772 3:17740962-17740984 CAGAGTGAGCAGGCTGAGTCTGG - Intronic
951476561 3:23112714-23112736 AGGACAGAGGAGAATGAGACTGG + Intergenic
951915480 3:27796656-27796678 TGCAGTGAGGTGAATGAGACCGG - Intergenic
951991493 3:28680092-28680114 CAGAGTCAAGAAAATGAGAGAGG + Intergenic
952130157 3:30352774-30352796 CAGAAAGAGGAAAATGAGACAGG + Intergenic
952957445 3:38565823-38565845 CTGACTGGGGAGGATGAGACAGG - Intronic
953127491 3:40105763-40105785 CAGAGAGAGAAGAGTGAGGCAGG + Intronic
954047397 3:47944350-47944372 CAGACTGTGGAGAATGAGAAAGG - Intronic
954060243 3:48061289-48061311 CTGAGGGAGGAGAATCAGGCAGG - Intronic
954297027 3:49679958-49679980 CAGAGCGAGAAGGATGAGTCTGG - Intronic
954608222 3:51929967-51929989 CAGAGTGAGAGGACAGAGACTGG - Intergenic
955286634 3:57647817-57647839 CAGAGTAACCTGAATGAGACAGG + Intronic
955354225 3:58217228-58217250 TAGGGTGAGGTTAATGAGACAGG - Intergenic
955674710 3:61435617-61435639 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
955887765 3:63618913-63618935 CAAAGTGGGGAGAATGAGACAGG + Intergenic
956042175 3:65156028-65156050 ATGAGTGAGGAAAATGAGACAGG - Intergenic
956407452 3:68943087-68943109 CAGGCTGAAGAGAACGAGACGGG + Intergenic
956760241 3:72436169-72436191 CACAGTTAGGAGTTTGAGACCGG - Intronic
956990603 3:74758840-74758862 CACATTTAGGAGAATGAAACTGG + Intergenic
957167869 3:76698357-76698379 CAGAGTGAGGATAGTGACAGTGG + Intronic
957421374 3:79975991-79976013 GAAAGTGAGGAGAAAGAGATAGG - Intergenic
957889153 3:86332653-86332675 CTGAGTCAGGAGTATGAGAGTGG + Intergenic
959526461 3:107382791-107382813 CAGTGTGATAAGAATAAGACGGG + Intergenic
960697916 3:120413888-120413910 CTGAGTCAGGAGAATCAGGCAGG - Intronic
960738563 3:120807345-120807367 CACAGTGAGGTGAATAAAACAGG + Intergenic
960744930 3:120876815-120876837 ATGAGTGTGGAAAATGAGACAGG + Intergenic
960962870 3:123084364-123084386 CAGAGTGGGGAGGCTGGGACAGG - Intronic
961006663 3:123410152-123410174 CAGAACTAGGAGAATGAGAAAGG + Intronic
961443415 3:126966384-126966406 CAGACTGAGCAGACTGAGACAGG + Intergenic
961702541 3:128757631-128757653 CCCAGTTAGGAGAATGAGGCAGG - Intronic
962418861 3:135209623-135209645 CAGATTGAGGGGCATGATACTGG + Intronic
963282692 3:143401161-143401183 AGGAGAGAGGAGAGTGAGACAGG + Intronic
964197515 3:154081814-154081836 AAGAGTGAGGGGAGTGGGACAGG - Intergenic
964357460 3:155863752-155863774 CTGAGAGGGGAAAATGAGACAGG - Intergenic
964413501 3:156423812-156423834 CAGAGTCAGGAAAATGAGCCAGG + Intronic
965120309 3:164546113-164546135 CAGAGTGGGGAGGGTGAGAAGGG + Intergenic
965151729 3:164986230-164986252 GAGAGTAAGGAGCAAGAGACAGG - Intronic
965510535 3:169563909-169563931 TAGAGGGAGGAGACTGAGAGAGG - Intronic
965687005 3:171314800-171314822 TAGAGTGAGGAGAAGGATTCAGG + Intronic
967978411 3:195048492-195048514 AAGAGTGAGCAGACTGATACTGG + Intergenic
968075644 3:195814681-195814703 CAGAATGGGGTGAATGAGAGGGG + Intergenic
968149428 3:196325414-196325436 CAAGGTCAGGAGATTGAGACCGG - Intronic
968201983 3:196762585-196762607 CTGAGGCAGGAGAATCAGACAGG + Intronic
968288174 3:197520173-197520195 GAGAGGGAGGAGAGGGAGACGGG + Intronic
968788226 4:2640426-2640448 CAGAGTGAGAAGATTTAGGCTGG + Intronic
970195376 4:13546546-13546568 TATAGTGAGGAGATTGACACTGG + Intergenic
970310704 4:14779464-14779486 GAGAGATAGGGGAATGAGACTGG - Intergenic
971344161 4:25797059-25797081 GAGAGGGAGGAGAAAGAGAAAGG + Intronic
971764875 4:30817979-30818001 CTGAGTGAGAAGAATGTGGCAGG - Intronic
971766186 4:30835190-30835212 CAGAGTCAGCAGATTGAGACAGG + Intronic
972422728 4:38904817-38904839 AAGAGTAAAGAGGATGAGACAGG + Intronic
972437292 4:39045572-39045594 CGGAGTGTGGAGAATAAGACGGG + Intronic
972965861 4:44508763-44508785 CACAGTGAGGAGAAGGAAAAAGG + Intergenic
973195485 4:47434905-47434927 GAGAGTGAACAGAATGAGGCAGG - Intergenic
975185205 4:71393957-71393979 CACAGGTAGGAGAATGAAACTGG + Intronic
976132915 4:81904061-81904083 GAGAGGGAGGAGAAGGATACAGG - Intronic
976195563 4:82528553-82528575 GAGAGAGAGGAGAATGAGAGAGG - Intronic
976286887 4:83379176-83379198 AAGGGTGAGAAGAATAAGACAGG - Intergenic
977204969 4:94157381-94157403 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
978303461 4:107295404-107295426 CAGAGTGAGGACAAGGACAGAGG + Intergenic
978714020 4:111820250-111820272 AAGAGTGAGGAAAATTATACAGG + Intergenic
979289927 4:118968241-118968263 CAGGGTCAGGAGAATGTCACTGG + Intronic
979832532 4:125318500-125318522 CACATTAAGGAGAATGAGCCTGG + Exonic
979897751 4:126181092-126181114 GAGAATGAGGAAGATGAGACTGG - Intergenic
979902668 4:126243033-126243055 CAGAGTGGGAAGAAATAGACAGG - Intergenic
980028391 4:127794228-127794250 GAGAGTGAGGAAAATAGGACAGG + Intronic
980238240 4:130136461-130136483 CAGATGTAGGAGAATGAAACTGG + Intergenic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
982266706 4:153544529-153544551 TGGAGTGAGGAGAGTGAGGCAGG - Intronic
982802458 4:159722132-159722154 CCGAGTGAGCAGAACGAGCCCGG - Intergenic
983118210 4:163846491-163846513 GAGAGTGAGGAGGATGTCACTGG + Intronic
983276479 4:165623663-165623685 CAGATTGAGAGAAATGAGACAGG - Intergenic
984080915 4:175249025-175249047 TAGATTGAGGACAATGAGAAGGG + Intergenic
985240309 4:187924337-187924359 CACAGGTAGGAGAATGAAACTGG - Intergenic
985627508 5:997312-997334 GAGGGTGGGGAGGATGAGACAGG - Intergenic
985923919 5:3000837-3000859 CACAGTGGGAGGAATGAGACAGG + Intergenic
986067067 5:4245154-4245176 CAGAATGAGGAGGAAGAGAAAGG - Intergenic
986742492 5:10716135-10716157 CAAAGTGATGAGAACGTGACAGG + Intronic
987268154 5:16277748-16277770 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
988664448 5:33310042-33310064 CAGAGGGTGGAAAATGAGAGAGG - Intergenic
989157155 5:38355107-38355129 GAGAGTGGGGAGAATGAGACAGG + Intronic
989165993 5:38434026-38434048 CAGAGGGAGGAGAATGAATCTGG - Intronic
989474256 5:41856478-41856500 CGGTGTGAGGAGTATGAGAGTGG - Intronic
989633339 5:43510537-43510559 CTGAGGCAGGAGAATCAGACAGG - Intronic
990327101 5:54689212-54689234 CAGATGGAGAAGAATGAGAAAGG - Intergenic
991656913 5:68913525-68913547 CAGAGTGAAAATAATGAGAGGGG - Intergenic
992274086 5:75096835-75096857 CAGAGTGGGGAAAATCACACTGG - Intronic
992304340 5:75420560-75420582 CATGGTCAGGAGATTGAGACCGG - Intronic
992595916 5:78347296-78347318 GAGAGAGTGGAGAATGAGACAGG - Intergenic
992946373 5:81814822-81814844 AAGAAGGAGGAGAATAAGACTGG + Intergenic
993454563 5:88112767-88112789 CACAGTGAGGAGGATGAAATAGG + Intergenic
994082023 5:95717602-95717624 CAGAGGCAGCAGAATGAGACAGG - Intronic
994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG + Intronic
994200826 5:96973984-96974006 CAGAGGTAGGAGACAGAGACAGG - Intronic
994832651 5:104805984-104806006 AAAAGTGAGAAGAATGAGAGGGG + Intergenic
995466786 5:112458163-112458185 CAGAAAGAGAAGAAAGAGACAGG + Intergenic
995533953 5:113117180-113117202 CAGAGTGAGGAGAGAGGGTCGGG - Intronic
995858330 5:116616305-116616327 CAGTGGGAGGAGTATGAGAAGGG - Intergenic
995942507 5:117600683-117600705 CTGAGGCAGGAGAATCAGACAGG + Intergenic
996410985 5:123158803-123158825 AAAAATGAGGAGACTGAGACTGG - Intronic
996457670 5:123703405-123703427 GAGTGTGAGGAGAATGGGAGTGG + Intergenic
996486959 5:124047088-124047110 TAGAGTGAAGAGAAAGAGAGAGG + Intergenic
997123824 5:131205150-131205172 GAGAGAGAGGAGAAAGAGAAGGG - Exonic
997297742 5:132778166-132778188 CAGAGGGAAGAGAAAGAAACGGG - Intronic
997875120 5:137538978-137539000 CTGAGGCAGGAGAATGAGGCAGG + Intronic
998350529 5:141497483-141497505 CAGAGAGAGGAGAGAGAGAGAGG - Intronic
998611434 5:143693443-143693465 CAAAGAGAGGAGACAGAGACAGG + Intergenic
999433064 5:151540475-151540497 GAGAGTGAGGAGCAGGAGAAGGG - Intronic
999585275 5:153082780-153082802 AAAAGTAAAGAGAATGAGACTGG + Intergenic
999726856 5:154445356-154445378 CAGAGTGTGGAGAGTGGGACTGG - Intergenic
1000578685 5:163008964-163008986 CAGAGGGAGGAGAAAGAGAGTGG - Intergenic
1000943066 5:167386708-167386730 CACAGGTAGGAGAATGAAACTGG - Intronic
1001295172 5:170494100-170494122 CTGAGTGAGGAGACTGAGGAAGG - Intronic
1002156658 5:177286919-177286941 CAGGATGGGGAAAATGAGACAGG + Intronic
1003509188 6:6765196-6765218 AAGAGTGAGAAGAATGGGAGGGG + Intergenic
1003820802 6:9895037-9895059 AAGAGTGAGGAGGATGAGAGGGG - Intronic
1004152337 6:13133390-13133412 CTGAGGCAGGAGAATCAGACAGG - Intronic
1004239325 6:13904561-13904583 GAGCCTGAGGAGATTGAGACTGG - Intergenic
1004491621 6:16122629-16122651 CAGGGTAAGGAGAAGCAGACTGG + Intergenic
1006258696 6:32851168-32851190 GAGAGTGAGGTGAATCAGACAGG + Intronic
1006301878 6:33198086-33198108 AACAGTGAGGAGACTGGGACTGG - Intronic
1007983163 6:46179891-46179913 AAGAGTGAGGACAAGGAGGCAGG + Intergenic
1008421747 6:51309016-51309038 CAGAGTGAGGGGCATGGGCCAGG - Intergenic
1008490995 6:52087229-52087251 CAGAGAGAGGAGAGAGAGAGAGG - Intronic
1009498575 6:64382238-64382260 GAGAGTGAAGAGAATGAGATAGG - Intronic
1010066565 6:71688812-71688834 TAGAGGGAGGAGGATGAGAAGGG - Intergenic
1010366988 6:75062573-75062595 CAGAGGGGAGAGAATGAGACTGG - Intergenic
1010512999 6:76743761-76743783 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1010613961 6:77990619-77990641 AAGAGAGAGGAGAAGGAGAGGGG - Intergenic
1010675223 6:78735698-78735720 CATATTCAGAAGAATGAGACTGG - Intergenic
1010738954 6:79476707-79476729 CAGAGAGAGGAGAATGAAGAAGG + Intergenic
1010948732 6:82009567-82009589 TAGAGGGAGGAGAAAGAGAGTGG + Intergenic
1011577977 6:88825851-88825873 CAGAGTGAGGAGAAGGATAGTGG - Intronic
1013080633 6:106808880-106808902 CAGAGAGAGGAGAGAGAGAGAGG - Intergenic
1013191823 6:107810199-107810221 CAGAGTGAGAAGAGCGAGCCTGG - Intronic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1014755048 6:125293293-125293315 CTGAGTGGGGAGAATGGGAAAGG + Intronic
1015188966 6:130452251-130452273 CAGAATGTGGAAAATGACACAGG - Intergenic
1015236600 6:130978339-130978361 CAGAAGGAGGATAGTGAGACAGG - Intronic
1015292987 6:131559664-131559686 CTGAGGCAGGAGAATGAGAATGG - Intergenic
1015353854 6:132254075-132254097 CAGAGAGAGGAGAATGGCAGAGG + Intergenic
1015552719 6:134428792-134428814 CAGGTTGTGGAGAAGGAGACTGG + Intergenic
1015846165 6:137522896-137522918 AAGAGGGAGGAGAAAGAGAGGGG + Intergenic
1016406964 6:143741147-143741169 CTGAGGCAGGAGAATGAGTCAGG + Intronic
1016809527 6:148246131-148246153 GAGAGAGAGGAGAGAGAGACAGG - Intergenic
1016858216 6:148693523-148693545 CTGAGTCAGGAGACTGAGGCAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016958468 6:149649230-149649252 CAGAGGGTGGAGATTGAGACTGG - Intergenic
1017616359 6:156250703-156250725 AAGAGTGAGGAGAAAGAGACTGG - Intergenic
1018108545 6:160512737-160512759 CAGGGAGAGGAGAATGAAAAGGG - Intergenic
1018487168 6:164252704-164252726 CACAGAGAGGAGAATGAAACAGG - Intergenic
1019088493 6:169503126-169503148 CAGAGTGACGAGAAAGAGGCAGG + Intronic
1020780463 7:12511083-12511105 CACAGGCAGGAGAATGAAACTGG - Intergenic
1021584267 7:22190996-22191018 CAGATGGAGGAAAATGAGAAGGG - Intronic
1021634560 7:22679036-22679058 CAAGGATAGGAGAATGAGACAGG - Intergenic
1021785865 7:24152079-24152101 CAGACTGGGGAGAAGGAGAAGGG - Intergenic
1021846430 7:24767453-24767475 GGGAGGGAGGAGAATGAGACTGG - Intergenic
1021923763 7:25514705-25514727 GAGAGTAAGGAGAATGAGTTTGG - Intergenic
1021936713 7:25638605-25638627 CAGAGTGATGACAAGGAGACTGG - Intergenic
1022258852 7:28685043-28685065 CAGAGTGAGGAAAAACAGCCTGG - Intronic
1022374020 7:29796714-29796736 CAGAGTCAGGTGAATGTGAGGGG + Intergenic
1022514719 7:30968306-30968328 GAGAGCAAGGAGAATGACACAGG + Intronic
1023188943 7:37558664-37558686 CAGAGTGAGGAGATTGGGAAGGG + Intergenic
1023477790 7:40599766-40599788 TAGAGTGAGGAAAATAAGAAAGG - Intronic
1023544387 7:41302408-41302430 CACATGTAGGAGAATGAGACTGG + Intergenic
1023709061 7:42972697-42972719 CAGAGTGAGGAGAGCAAGATTGG + Intergenic
1024009198 7:45253318-45253340 GAGAGAGAAGAGAAGGAGACAGG - Intergenic
1024846906 7:53655828-53655850 CAGAGTGAATAAAATGAAACAGG + Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025072320 7:55910952-55910974 CACAGTCAGGAGAAGCAGACGGG - Intronic
1026095694 7:67344814-67344836 CTGAGAGAGGAGAAAGAAACCGG + Intergenic
1026571148 7:71532169-71532191 CAAAGTCAGGAGAAGGAAACAGG - Intronic
1026580173 7:71609123-71609145 CTGAGTGAGAAGACTTAGACAGG - Intronic
1026955052 7:74371751-74371773 GAGAGGGAGGAGAAGGAGAGAGG + Intronic
1027487853 7:78784353-78784375 GAGAATGAGGAGCAAGAGACAGG - Intronic
1027650580 7:80862887-80862909 CACATGGAGGAGAATGAAACTGG + Intronic
1028522913 7:91752382-91752404 GAGAGTGAGGAAAATCAGAGTGG + Intronic
1028703248 7:93808190-93808212 CACAGGTAGGAGAATGAAACTGG + Intronic
1029362531 7:100097875-100097897 AAGAGTGAGGATGATGAGTCTGG - Exonic
1029787270 7:102805376-102805398 CACAGTGACCTGAATGAGACTGG + Intronic
1029813203 7:103069523-103069545 CAGTCTGAGGAGACAGAGACTGG + Intronic
1030112451 7:106038423-106038445 CAGAGTGATGAGCATGAGGCTGG + Intergenic
1030681772 7:112441582-112441604 CAGAGAGGAGAGAATGAAACAGG - Intronic
1030692548 7:112551115-112551137 AGGAGTGAGGAGAATCAGGCAGG - Intergenic
1030810449 7:113966316-113966338 CAGAGTGAGGAGGATGAAAGAGG + Intronic
1030829119 7:114198785-114198807 AAGAGTGGGGAGAAGGAGAGAGG + Intronic
1030860155 7:114615590-114615612 CACAGTGAGGAGGCTGAGTCTGG - Intronic
1031597969 7:123669578-123669600 AAGAGTGTGGAGAATGACAGAGG + Intergenic
1031763202 7:125740444-125740466 GGCAGTGTGGAGAATGAGACTGG - Intergenic
1031879625 7:127181788-127181810 CACATGGAGGAGAATGAAACTGG + Intronic
1032189058 7:129752404-129752426 GAGAGTGAGGGAGATGAGACTGG + Intronic
1032906575 7:136374374-136374396 CAAAGAGAGAAGAATGAGAAGGG + Intergenic
1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG + Intronic
1033463301 7:141567153-141567175 CAGAGTGTGTAGAATGAGAATGG - Intronic
1034370011 7:150586814-150586836 CAGAGGGAGGAGAGTGAGCTTGG - Intergenic
1034379241 7:150675686-150675708 CAGAGTGGGGGTAATGAGAAAGG - Intergenic
1034466141 7:151230269-151230291 AAGAGAGAGGAGAAAGGGACTGG + Intergenic
1034574774 7:151987594-151987616 AAGAGTGAGGAGAGCAAGACTGG + Intronic
1034940810 7:155229000-155229022 CAGCTTGAGCAGAATGAGACTGG - Intergenic
1034953983 7:155321957-155321979 CAGAGTGAGAAGAATTAGGAGGG + Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035165132 7:156985095-156985117 CACAGTGGGGAGCATGGGACTGG - Intergenic
1037134912 8:15449166-15449188 CAGAGTGGGAAGAATAGGACAGG + Intronic
1037616116 8:20520300-20520322 CAGAGAGAGGGGAAGGAGAGTGG - Intergenic
1038147938 8:24915035-24915057 CGGAGTGTGGAGGATGAGATGGG - Intronic
1038649465 8:29389282-29389304 CAAAGTCAGGAGTTTGAGACCGG + Intergenic
1038787127 8:30628546-30628568 CAGAGTAAGAAGATTGAGAAAGG + Intronic
1038823149 8:30971789-30971811 TATAGTGATGAGAATGAGAAAGG + Intergenic
1039162204 8:34634852-34634874 TAGAGGGAGGAGGAAGAGACAGG + Intergenic
1039559770 8:38503779-38503801 CGGAGTGGGAAGAAGGAGACTGG - Intergenic
1039683024 8:39763244-39763266 CAGAGTGAGGTAAATTAGATAGG + Intronic
1039782237 8:40797016-40797038 CAGAGTGAGGGGAGTGAGTCTGG - Intronic
1039829624 8:41202444-41202466 CAGAGTGACGAGAATGTGGGTGG + Intergenic
1040521519 8:48180196-48180218 GAGAGTGAGGAGAAGGAGAAGGG + Intergenic
1040826179 8:51623138-51623160 CAGAGAGAGGACAATGAAAGAGG - Intronic
1041536022 8:58926292-58926314 CAGAGTGAGGACCAGAAGACTGG - Intronic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1042392059 8:68247412-68247434 CATAGGTAGGAGAATGAAACTGG - Intergenic
1043615997 8:82126401-82126423 AGGAGTAGGGAGAATGAGACAGG + Intergenic
1044096904 8:88078099-88078121 GAGGGAGAGGAGAAAGAGACAGG - Intronic
1044157141 8:88861471-88861493 CAGAGAGAGGATAAAGGGACGGG - Intergenic
1044298342 8:90554524-90554546 CAGAATGTGGAGCATGACACAGG + Intergenic
1044731341 8:95230975-95230997 CTGAGAGAGAAGAATGAGGCAGG + Intergenic
1045206259 8:100044215-100044237 CAGAATGAGCAGAATGAGTTGGG - Intronic
1045316200 8:101045819-101045841 CAGGGTGAGTAGAATGGGATAGG + Intergenic
1045550161 8:103164240-103164262 CAGAGTGAGGTGAAAGTAACTGG + Intronic
1045890082 8:107145699-107145721 GAGAGTGGGAAGAATGAGGCAGG + Intergenic
1046250772 8:111628101-111628123 CACAGGTAGGAGAATGAAACTGG - Intergenic
1047020939 8:120774535-120774557 CAGAATGTGGTGAATGAGAGAGG + Intronic
1047063705 8:121256664-121256686 AGGAGAGAGGAGCATGAGACAGG - Intergenic
1047174552 8:122528134-122528156 GAGAGTAAGGAGAATGAGCTGGG + Intergenic
1047521497 8:125598634-125598656 GACAGTGAAAAGAATGAGACAGG - Intergenic
1048159965 8:132008692-132008714 CAGAGTGGGGAGAAATTGACTGG + Intronic
1048266307 8:132990565-132990587 CAGAGGGAGGGGGAGGAGACAGG - Intronic
1048460261 8:134615567-134615589 GGGAGTGAGAAGAGTGAGACAGG - Intronic
1048838887 8:138547381-138547403 GAGAGAGAGGAGAGTGAGAGGGG - Intergenic
1049282564 8:141757861-141757883 AACAGTGAGGTGAGTGAGACAGG - Intergenic
1049614772 8:143571362-143571384 CGGAGTGGGGTGAATGAGGCTGG - Intronic
1050040928 9:1492652-1492674 CAGAGGGAGGAGGATGAGCTAGG + Intergenic
1050222791 9:3413619-3413641 CAGAGCAAGGAGAAAGAAACAGG - Intronic
1050558838 9:6812741-6812763 CAGAGTCAGGTGACAGAGACAGG - Intronic
1050624399 9:7487634-7487656 GAGAAGGTGGAGAATGAGACTGG + Intergenic
1050722708 9:8608925-8608947 CAGAGTGATGAGACTCAGACAGG + Intronic
1050971924 9:11888743-11888765 CACAGGCAGGAGAATGAAACTGG - Intergenic
1051276706 9:15405933-15405955 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1053109579 9:35446169-35446191 GAGAGTGAGAGGAAAGAGACGGG + Intergenic
1053467854 9:38324132-38324154 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1056220710 9:84448310-84448332 CAGAGTCAGAAGTAGGAGACAGG + Intergenic
1056332713 9:85534886-85534908 GAGAGAGAGGAGAAGGAGACAGG - Intergenic
1056385358 9:86092362-86092384 CAGAGTCAGGAGAAGGAAAGAGG - Intronic
1056508949 9:87284457-87284479 ATGAGTGAGAAGAAAGAGACAGG - Intergenic
1057570787 9:96202868-96202890 TGGATTGAGGAGAATGAGAAGGG + Intergenic
1057697045 9:97330615-97330637 CTGAATGAGGAGAATGTGAAGGG + Exonic
1059226129 9:112674844-112674866 GGCAGTGAGGAGAATGAGAAGGG - Intergenic
1059483817 9:114611865-114611887 CAGAGGGCGGAGACTGAGACTGG + Intronic
1060527198 9:124327312-124327334 CAGGGCGAGGAGAAGGAGATTGG - Intronic
1061164245 9:128913235-128913257 CAGAGTGAGGAGAGAGACAGCGG + Intronic
1062051075 9:134447420-134447442 CAGAGGGAGGAGGATGCGGCTGG + Intergenic
1062678518 9:137763124-137763146 CAAAGTGAGTAGATTGAGGCAGG + Intronic
1062714066 9:137995478-137995500 CACAGGTAGGAGAATGAAACTGG + Intronic
1062714270 9:137998133-137998155 GAGAGGGAGAGGAATGAGACTGG + Intronic
1185751190 X:2610643-2610665 GAGAGTGAGGAGATAGAGAGAGG - Intergenic
1185940591 X:4314664-4314686 CAGAGAGAAGAGAGAGAGACAGG + Intergenic
1188809485 X:34635346-34635368 AAGAGTATGGAAAATGAGACGGG - Intronic
1189221585 X:39376703-39376725 CAGAGTGGGGAGAAAGGGATTGG + Intergenic
1189232106 X:39460608-39460630 GACAGGAAGGAGAATGAGACTGG - Intergenic
1189982791 X:46528040-46528062 CAGGGTGAGAGGAATGAGAAGGG + Intronic
1191222916 X:58009780-58009802 CACAGTTAGGATAATGACACTGG - Intergenic
1192225255 X:69222996-69223018 CAGAGTGAGCAAAATGAGGCAGG + Intergenic
1192230350 X:69260330-69260352 CAGTGTGTGGAGAATGGGAGTGG + Intergenic
1192656356 X:72999063-72999085 CTGAGTGAGGATATTGAGGCTGG + Intergenic
1192665764 X:73083938-73083960 CTGAGTGAGGATATTGAGGCTGG - Intergenic
1192794304 X:74413252-74413274 CTGAGTTAGGAGAATCAGGCAGG + Intergenic
1192943547 X:75939297-75939319 CATAGGCAGAAGAATGAGACTGG - Intergenic
1194104205 X:89748342-89748364 CACATTTAGGAGAATGAAACTGG - Intergenic
1194128771 X:90053305-90053327 CAGAAGGGGGAGAATGGGACGGG + Intergenic
1194742691 X:97594231-97594253 CACAGTGAGGAGAAAGAATCTGG + Intronic
1195202744 X:102565618-102565640 GAGAGGGAGGAGAGTGAGAGGGG + Intergenic
1195883263 X:109614520-109614542 CAGAGAGAGGAGAGAGAGAGAGG + Intergenic
1196463321 X:115950523-115950545 CACAGGGAAGAGAAGGAGACTGG + Intergenic
1196534356 X:116824634-116824656 GAGGGTGGGAAGAATGAGACAGG + Intergenic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1197984663 X:132254895-132254917 CAGAGGGAGAACAAGGAGACAGG + Intergenic
1198784563 X:140273179-140273201 GAGAGTGAGCAGAATCAGAATGG - Intergenic
1198833390 X:140775870-140775892 CAGATTGAGGAGAAAGTTACTGG - Intergenic
1199093021 X:143713262-143713284 GAGAATAAGGAGAATGGGACTGG - Intronic
1199586284 X:149420235-149420257 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1199668958 X:150125792-150125814 CACAGGTAGGAGAATGAAACTGG + Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200456159 Y:3396151-3396173 CACATTTAGGAGAATGAAACTGG - Intergenic