ID: 1125062187

View in Genome Browser
Species Human (GRCh38)
Location 15:35437741-35437763
Sequence TTTGCCACTGACTGGTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 8, 3: 28, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125062187_1125062191 14 Left 1125062187 15:35437741-35437763 CCAGCAAACCAGTCAGTGGCAAA 0: 1
1: 0
2: 8
3: 28
4: 192
Right 1125062191 15:35437778-35437800 TCTATCTTGTTTTATGTCCTTGG 0: 3
1: 40
2: 63
3: 166
4: 548

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125062187 Original CRISPR TTTGCCACTGACTGGTTTGC TGG (reversed) Intronic
900569088 1:3349581-3349603 TTTCCCACTGGCTGGTGTGCTGG + Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
902603652 1:17556511-17556533 TTGGCCACACCCTGGTTTGCTGG + Intronic
903831778 1:26179605-26179627 TTGGCCACTGTCTGGTTCGTGGG - Intronic
905688945 1:39928646-39928668 TTTTCCACAGACTGGGGTGCGGG - Intergenic
908900867 1:68955033-68955055 TTGGCCATTGACTGATTTACAGG - Intergenic
915506349 1:156358900-156358922 TTTGTCTCTGACTGGTGAGCTGG + Intronic
919964627 1:202510288-202510310 ATTGCTACTGACAGGTTTGAAGG - Intronic
1063347644 10:5326424-5326446 TCTGCCACTGACTGTTTACCAGG + Intergenic
1065373970 10:25017468-25017490 TTTCTCACTGCCTGGTTGGCTGG + Intronic
1067250295 10:44580777-44580799 TTTGCCTCTCAAAGGTTTGCTGG + Intergenic
1068306597 10:55218453-55218475 TTTGCCATTGACTCTTTTTCTGG + Intronic
1069640178 10:69949830-69949852 TTTTCAGCTGGCTGGTTTGCAGG - Intronic
1070836853 10:79452927-79452949 GGTGCCACTGTCTGGTTTTCAGG - Intergenic
1071862923 10:89693981-89694003 TACACCACTGACTGGTTTGTTGG - Intergenic
1074802481 10:117015086-117015108 TTTTTCCCTGACTGATTTGCAGG + Intronic
1076782514 10:132732011-132732033 ATTGCCACTGCCTGGGGTGCCGG - Intronic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1079083555 11:17430044-17430066 TTTGTTACTGACTGGTTCTCTGG + Intronic
1081063480 11:38508849-38508871 TTTGACAATGACTGTTTCGCTGG + Intergenic
1081558134 11:44186493-44186515 GTTGCCACTGATTGCTTTTCAGG - Intronic
1084344115 11:68532514-68532536 TGCTCCACTGACTGGTTTGTTGG + Intronic
1084351812 11:68606844-68606866 TTTGCTACTGACTTGGTTGTAGG - Intronic
1084519066 11:69652005-69652027 TTTGTCACTGGATGGTTTGTTGG - Exonic
1084961076 11:72717029-72717051 ATTGCTACTGACTGGGCTGCGGG - Intronic
1085211386 11:74782538-74782560 TTTTCCACTGACTGGTGTAGGGG - Intronic
1085580087 11:77642719-77642741 TTTGGAACTGACTAGTTTGCTGG - Intergenic
1085608305 11:77922842-77922864 TTTTCCAGTGACTGGTTTGCTGG + Intronic
1086486071 11:87303351-87303373 TTTTCCACTGACTGGGTGGCTGG - Intronic
1089706781 11:120283825-120283847 TATTCCACTGACTGGTGGGCAGG - Intronic
1090969111 11:131624250-131624272 GTTGCCACTGAATGATGTGCTGG - Intronic
1093490701 12:19701005-19701027 GTTACCACTTACTGCTTTGCTGG + Intronic
1093920765 12:24856807-24856829 TTTGTAACTGACCAGTTTGCGGG - Intronic
1094073026 12:26440083-26440105 TTTGCCACTGACTGGTGTGGTGG + Intronic
1095289046 12:40454577-40454599 TTTGCCACTAACTTGTTCTCTGG + Intronic
1097580874 12:61454800-61454822 TTTGCCACAGACTGATGTGGGGG + Intergenic
1099402040 12:82211953-82211975 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1100268642 12:93002437-93002459 CTTGCCAGTGACTGGTTTGGAGG - Intergenic
1102532808 12:113559069-113559091 TTTCCCACTGGCTAGGTTGCAGG + Intergenic
1102808380 12:115802131-115802153 TTTCCCACTTACAGCTTTGCAGG - Intergenic
1102824970 12:115941327-115941349 TTTGGTAATGACTGGTTTTCTGG + Intergenic
1104103801 12:125640210-125640232 TTTGCCAATGATTGGTTTAGGGG - Intronic
1105762043 13:23524286-23524308 TTTGCCAGTGATTGGTTTAAGGG + Intergenic
1106424136 13:29609779-29609801 TTTGCAGCTGTCTGGTTTACAGG - Intergenic
1106541859 13:30697525-30697547 TTGGGCATTGACAGGTTTGCAGG - Intergenic
1106684399 13:32042774-32042796 TTTGCCAGTGACTGGTCTAAGGG - Intronic
1107048150 13:36015960-36015982 CTAGCCACTGAGTGATTTGCTGG - Intronic
1111866622 13:93776823-93776845 TTCCCTGCTGACTGGTTTGCAGG + Intronic
1116565148 14:46435548-46435570 TCTGCCACTGTCTGATTTTCTGG - Intergenic
1118187976 14:63554779-63554801 TTTTCCACTGACTGGGGTGTGGG + Intergenic
1118393096 14:65312923-65312945 TTTGCCAATGGATGGTTGGCTGG - Intergenic
1119648458 14:76366137-76366159 TTTGACAGTGATTGGTTTGGGGG + Intronic
1119948771 14:78722920-78722942 TTTTCCCCTGCCTGGTCTGCCGG - Intronic
1120305059 14:82759569-82759591 TTTCCTACTGAAAGGTTTGCAGG + Intergenic
1122940842 14:104980710-104980732 TATGCCTCTGCCTGGTCTGCTGG + Intergenic
1124440253 15:29680491-29680513 TTTTCCATGGACTGGGTTGCAGG + Intergenic
1125062187 15:35437741-35437763 TTTGCCACTGACTGGTTTGCTGG - Intronic
1126245273 15:46498020-46498042 TCTGCCACTGGCTGGCATGCAGG - Intergenic
1126826205 15:52551818-52551840 TTTGAGACTGACAGCTTTGCAGG - Exonic
1127317208 15:57808360-57808382 TTGGCCCCTGAGTGGTTTGCAGG + Intergenic
1128451632 15:67809171-67809193 TTTGGGGCTGACAGGTTTGCTGG - Intergenic
1130457635 15:84128858-84128880 TTTGCCACTAACTAGTTTTATGG + Intergenic
1130888240 15:88111493-88111515 TTTGACACTCACTGGTTTGTGGG + Intronic
1135065428 16:19305583-19305605 TCTGCCACTTACTGGCTGGCAGG + Intronic
1135998277 16:27269469-27269491 TCTGCCACTTACTAGTTGGCAGG + Intronic
1140262087 16:73389169-73389191 TGTGCCACTGCCTGCTTTGGAGG - Intergenic
1142014449 16:87737163-87737185 TGTGCCACTGACTGCTTTCCTGG - Intronic
1142170946 16:88622509-88622531 AGTCCCACTGACTGGTCTGCAGG - Intronic
1143646786 17:8235362-8235384 TTTGCCACTGCCTGGGTTCCAGG + Intronic
1144253987 17:13447362-13447384 TTTGCTGCTGTCTGGTTTACTGG + Intergenic
1144593121 17:16541594-16541616 TTTGCCACTGGATACTTTGCTGG - Intergenic
1144720513 17:17466395-17466417 TTGGCCAGTGACTGGTCTACAGG - Intergenic
1150151030 17:62808784-62808806 TCTGCCACTGACTGGGTGCCTGG - Intergenic
1150677235 17:67254972-67254994 TTTGCCCCTGGCTGGAGTGCAGG - Intergenic
1152553991 17:81044048-81044070 CTTGCCACTGTCTGCTTTCCTGG + Intronic
1153148934 18:2067865-2067887 TTTTCAGCTGACTGGGTTGCAGG - Intergenic
1155403987 18:25467735-25467757 TTTGCCACAGCCTGGGCTGCTGG + Intergenic
1156412353 18:36843194-36843216 TTTGCACATGAATGGTTTGCTGG + Intronic
1156452125 18:37272915-37272937 TTTGCCACAGAATGGTCCGCTGG + Intronic
1160972068 19:1773949-1773971 TTTGCAAGTGTCTGGTCTGCAGG + Intronic
1161763354 19:6190647-6190669 TGTACCACTGACTGCTTTGATGG + Exonic
1162565070 19:11441438-11441460 TTTGCCCCTGACTGCTGTTCTGG + Intronic
1167416366 19:49375152-49375174 TTTGCCATGGCCTGGTTGGCAGG - Intergenic
1168217312 19:54935897-54935919 TTTTCCACAGACGGGTTTGGGGG - Intronic
1168548826 19:57276669-57276691 TTTGTTACTGACCAGTTTGCTGG + Intergenic
925951436 2:8915959-8915981 CTTGCAACTGACTGGTTTATGGG + Intronic
926618967 2:15029794-15029816 TTTGCCACTGACTGCCTGGGAGG + Intergenic
926927019 2:17997041-17997063 TTTGTTACTGACCAGTTTGCTGG - Intronic
928223069 2:29421190-29421212 TTTGCCACTCACTGCTATGTTGG - Intronic
928834047 2:35522188-35522210 TTTGCCACTGACCAGTTTGCTGG + Intergenic
929343311 2:40849742-40849764 TTTCTCAGTCACTGGTTTGCTGG + Intergenic
933347035 2:81101160-81101182 TTTGGCACTGTGTGGTTTCCAGG + Intergenic
935158737 2:100509706-100509728 TTTGAGACTGACAGCTTTGCAGG + Intergenic
936039764 2:109141304-109141326 GTTGCCACTGGCTGGCTTTCTGG + Intronic
936819198 2:116498136-116498158 TTTACCACTGATGGGTTGGCTGG + Intergenic
937023770 2:118680901-118680923 TTTGCCATTCACAGGTTGGCTGG + Intergenic
937158825 2:119741135-119741157 TTTGCCAGTGACTGGTCTAGGGG - Intergenic
938649160 2:133363238-133363260 TTTACCACTGACTAGTTCGGTGG + Intronic
939843702 2:147219352-147219374 TTTGTAACTGACCAGTTTGCTGG + Intergenic
940009879 2:149041451-149041473 TTTGCCAATGACTGGTTTCAGGG - Intronic
940023265 2:149178719-149178741 TATACCACTGACTGGTTTCCAGG - Intronic
940735044 2:157441251-157441273 TTTGGCACTGACTAAATTGCAGG - Intronic
942102232 2:172595619-172595641 TATGGCACTGACTGATGTGCAGG - Intronic
942429250 2:175892237-175892259 TTTGCCACTGACTGTTTCTAAGG + Intergenic
942620235 2:177837313-177837335 TTTGTTACTGACCAGTTTGCTGG - Intronic
943466630 2:188236443-188236465 TTTGTAACTGTCGGGTTTGCTGG - Intergenic
944976687 2:205061366-205061388 TTGACCACTGACTGATTTGCTGG + Intronic
946458086 2:219845401-219845423 TTTGCCACTGACTGGCTGTGTGG + Intergenic
946461293 2:219871087-219871109 TTTGTCACTGGCTGCTCTGCAGG + Intergenic
947271568 2:228342294-228342316 TTTGACTCTGACTATTTTGCTGG + Intergenic
947393261 2:229661837-229661859 TTTGCCACTTCATGGTTTACTGG + Intronic
1171442224 20:25174431-25174453 TTTGTAACTGACCAGTTTGCTGG + Intergenic
1174680906 20:52407304-52407326 CTTGCCAGTGACTGGCTTGGGGG + Intergenic
1175057397 20:56210689-56210711 TTTGCCTCTGGCTGGTCTGCTGG - Intergenic
1183325938 22:37194196-37194218 TTTGTAACTGACGAGTTTGCTGG + Intronic
1183384404 22:37506736-37506758 TTCTCCACTGACTGGGATGCTGG - Intronic
1184631476 22:45783977-45783999 TTTGTCCCTGACTGCTTTGCAGG + Intronic
952562470 3:34611266-34611288 CTTGTCACTGACTGCTTTTCAGG + Intergenic
952588049 3:34917119-34917141 TTTCCCACTGAGTGGTCTTCAGG + Intergenic
952839391 3:37631302-37631324 TGTGCCACTGACAGACTTGCAGG - Intronic
953278110 3:41524436-41524458 TTGGCCATTGACTTGTTTCCAGG - Intronic
953416226 3:42719623-42719645 TTTGTAACTGACCAGTTTGCTGG - Intronic
953647945 3:44772906-44772928 TTTGCCATTAACCAGTTTGCCGG + Intronic
954892456 3:53943687-53943709 TTTGCCACTTACTGGCTTTGGGG - Intergenic
955969216 3:64420301-64420323 TTTGTATCTGACTGCTTTGCAGG + Intronic
957656922 3:83092120-83092142 TTTGCTACTCAGTGGTTTGATGG - Intergenic
957977941 3:87471444-87471466 TTTGCCACTCATTGCTTTGATGG - Intergenic
959168204 3:102807493-102807515 TTGGCCACTGAATGTATTGCAGG + Intergenic
960329676 3:116343362-116343384 TCTGCCACTGACTGGCCTGAAGG + Intronic
960804906 3:121574278-121574300 TTTTCCACGGACTGGTTGGGGGG + Intronic
963435321 3:145258889-145258911 TTTGCCATTGAACAGTTTGCTGG + Intergenic
966721342 3:183065171-183065193 TTTATAACTGACTAGTTTGCTGG - Intronic
972396006 4:38660492-38660514 TTTGCCAGTGACTGGTTGGAGGG - Intergenic
972915716 4:43876093-43876115 CTTTCCAATGACTGGTTTACAGG - Intergenic
974922581 4:68260506-68260528 TTTGTAACTGACTGGTTTACTGG - Intergenic
976461580 4:85318967-85318989 TTTGTTACTGACCAGTTTGCTGG + Intergenic
977474707 4:97490846-97490868 TTTGCCAATGACTGGTGTTTAGG - Intronic
980851986 4:138394288-138394310 TTTACCACTGACTGGTTTGATGG + Intergenic
981770232 4:148300099-148300121 TTTGCCACTAACCAGTTTGCTGG - Intronic
982602674 4:157471124-157471146 TTCGTTACTGACTAGTTTGCTGG - Intergenic
982864181 4:160489428-160489450 TTTGCAACTGACCAGCTTGCTGG - Intergenic
982893050 4:160880312-160880334 TTTTCCACTCACTGCTATGCTGG + Intergenic
986831259 5:11581428-11581450 TTTGCCACAGACTCTTTTTCAGG + Intronic
987166205 5:15201264-15201286 TTTGTTACTGACCAGTTTGCTGG + Intergenic
989747478 5:44847239-44847261 TTTTCCACGGACGGGTTTCCGGG + Intergenic
990047681 5:51454609-51454631 TTAGCCACTGACTGTTAAGCTGG - Intergenic
990490849 5:56301351-56301373 TTTGCCAGTGACTGGTTTAAGGG + Intergenic
991037698 5:62144578-62144600 TTTGCTAATGACTAGTTGGCAGG - Intergenic
993745565 5:91592938-91592960 TTTGTTACTGACCAGTTTGCTGG + Intergenic
1000741241 5:164973000-164973022 TTTGTTACTGACCAGTTTGCTGG + Intergenic
1001677375 5:173529835-173529857 TTTGTCACTGATTGGTCTGGGGG + Intergenic
1003272682 6:4621254-4621276 TTTGCCAGTGACTGCTTAGTGGG + Intergenic
1004051819 6:12089648-12089670 TCTTCCACTGACTGGTATTCAGG - Intronic
1004799875 6:19134667-19134689 TGTTCCACTGTCTGGTCTGCTGG - Intergenic
1005767465 6:29027168-29027190 TTTGCCACTGCCTGGTTGAGTGG - Intergenic
1007041689 6:38727849-38727871 TTTTCCAGTGACTGGGTGGCAGG + Intronic
1007353206 6:41290662-41290684 TTTGTAACTGACTGGTTTACTGG + Intergenic
1007796375 6:44351709-44351731 TCTGACACTCACTGGTTTTCAGG + Intronic
1008291448 6:49721180-49721202 TTTGTAACTGACCAGTTTGCTGG + Intergenic
1008765293 6:54905254-54905276 TTTACTACTGACTGGGTGGCAGG + Intronic
1010420160 6:75664529-75664551 TTTGCCACTTACTGGTTATTTGG - Intronic
1011341519 6:86320449-86320471 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1012200904 6:96404897-96404919 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1013385489 6:109625679-109625701 TTTTCCACAGACTGGGTTGTGGG - Intronic
1013473923 6:110489781-110489803 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1013597978 6:111678172-111678194 TTTTCCACTGAATGTTTTCCAGG + Intronic
1015460453 6:133485484-133485506 TCTGCCACTGACTGGTTGTGTGG - Intronic
1016272690 6:142307003-142307025 TTTGCAACTGATAGGATTGCAGG + Intronic
1017005720 6:150027073-150027095 TTGGCCACGGATTGGTGTGCTGG - Intergenic
1017093780 6:150785933-150785955 TTTTCCACAGACTGGATTGTGGG - Intronic
1019076454 6:169392404-169392426 TTTGTTACTGACCAGTTTGCTGG + Intergenic
1020350655 7:7215165-7215187 TTTGCCACCGACTGCTTTGCTGG + Intronic
1022083094 7:27043903-27043925 ATAGCCACTGACTGGTATGAGGG - Intergenic
1022099830 7:27162313-27162335 TTTGCCTCTGGCTGGCTTTCAGG - Intergenic
1022336909 7:29430906-29430928 TTTGTCAATGACTGGCTTACAGG - Intronic
1022451413 7:30518970-30518992 TTTGACACTGACTGGGTTTGTGG + Intronic
1022747119 7:33183854-33183876 TTTGTAGCTGACTAGTTTGCTGG + Intronic
1023320225 7:38988753-38988775 TTTGCCACTTACTGTCTTGCAGG - Intronic
1023811761 7:43917412-43917434 TTTGCCACTGGCCAGTTTGCTGG - Intronic
1024350588 7:48359019-48359041 TTTGACACTTGCTGGTTCGCAGG + Intronic
1024817795 7:53291866-53291888 ACTGCCTCTGACTGGCTTGCAGG - Intergenic
1025844594 7:65184997-65185019 TTTTCCAGTGACTGGTTTGCTGG - Intergenic
1025894922 7:65691335-65691357 TTTTCCAGTGACTGGTTTGCTGG - Intergenic
1028389079 7:90294659-90294681 TTTGTAACTGACCAGTTTGCTGG + Intronic
1028949827 7:96621942-96621964 TTTGCCACTAACAGCTATGCTGG - Intronic
1030156269 7:106459248-106459270 TTTGCAACTGACCAGTTTGCTGG + Intergenic
1030745989 7:113167043-113167065 TTTGCTACTGACTGGTTTAGGGG + Intergenic
1032088599 7:128897250-128897272 TTTGTAACTGACAAGTTTGCTGG - Intronic
1032590347 7:133186563-133186585 TTAGCCATTGACTGGTTGTCTGG - Intergenic
1033161732 7:139002791-139002813 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1033578094 7:142705287-142705309 TTTGTAACTGACCAGTTTGCTGG - Intergenic
1034333623 7:150305776-150305798 CTTGCCACTGACTGTTTTCAAGG - Intronic
1034544596 7:151781580-151781602 GTAGCCACTGAATGGTCTGCAGG + Intronic
1034664420 7:152804114-152804136 CTTGCCACTGACTGTTTTCAAGG + Intronic
1036808088 8:11848803-11848825 TCTGAAACTGACTGTTTTGCTGG + Intronic
1036815247 8:11897522-11897544 TTTGCCAATAGCTGGTTTGTGGG + Intergenic
1038104315 8:24415773-24415795 TTGGCCACTCTCTGGTTTGGTGG - Intergenic
1038124777 8:24660695-24660717 TTTATCAGTGACTAGTTTGCTGG - Intergenic
1038260399 8:25988103-25988125 TTGGCCACTCACTGGATAGCAGG + Intronic
1039884786 8:41648682-41648704 TTTGCCCCTCCCTGGTTTCCTGG - Intronic
1041694736 8:60723981-60724003 TCTGCCACTGACTGGCTGGGTGG + Intronic
1042573883 8:70196886-70196908 TTTGTCACTGACTAGTTTTAAGG + Intronic
1050174039 9:2851594-2851616 GTTGCCACTGAGTGGCTTGTTGG + Intergenic
1050645231 9:7712629-7712651 TTTGCCTCTGATTGGTTTGGAGG - Intergenic
1060211283 9:121712058-121712080 TTTGCCATGGATAGGTTTGCCGG + Intronic
1061825839 9:133257686-133257708 TTTGCCTCTGGTTGGTTTCCCGG - Intronic
1187354039 X:18550011-18550033 TTTCCCACTGACAGGTTCACTGG - Intronic
1188133883 X:26470742-26470764 TTTGTAACTGACCAGTTTGCTGG + Intergenic
1188170385 X:26917781-26917803 ATTGCCACTGACAGCATTGCAGG - Intergenic
1188251906 X:27906641-27906663 TTTCTCACTGACAAGTTTGCAGG - Intergenic
1188802617 X:34550377-34550399 CTTGCAACTGACTAGTTTGCTGG - Intergenic
1189086530 X:38031015-38031037 TTTGTAACTGACCAGTTTGCTGG + Intronic
1189629052 X:42932340-42932362 TTTTCCAGTGACTGTTTAGCGGG + Intergenic
1189649985 X:43178345-43178367 TTTGCTACTGACCAGTTTGCTGG - Intergenic
1191017496 X:55825822-55825844 TGTGCCAATGTCTGGTTTGGTGG - Intergenic
1191113301 X:56825288-56825310 TTTGCCACTTTCTTGGTTGCAGG + Intergenic
1191119455 X:56888335-56888357 TTTGTAACTGACAAGTTTGCTGG - Intergenic
1192777049 X:74256010-74256032 TTTGCCACTGACCGCTTTGCTGG - Intergenic
1194138482 X:90177952-90177974 TTTGTCACTGACCAGCTTGCTGG + Intergenic
1194187734 X:90793979-90794001 TTTGTCACTGACTAGCTTGCTGG - Intergenic
1196041901 X:111213944-111213966 TTTGTCACTGACTTGTATGTTGG + Intronic
1197959119 X:131985147-131985169 TTTCCTTCTGACTGGTTTCCAGG + Intergenic
1199986673 X:152957676-152957698 TTTGTCACTGACCAGCTTGCTGG + Intronic
1200484279 Y:3748189-3748211 TTTGTCACTGACCAGCTTGCTGG + Intergenic
1200534321 Y:4375931-4375953 TTTGTCACTGACTAGCTTGCTGG - Intergenic
1200859411 Y:7974486-7974508 TTTGCCACTGATCAGTTTGCTGG - Intergenic
1202259864 Y:22959124-22959146 TTTGGCACTAACCAGTTTGCTGG + Intergenic
1202412850 Y:24592868-24592890 TTTGGCACTAACCAGTTTGCTGG + Intergenic
1202457931 Y:25077202-25077224 TTTGGCACTAACCAGTTTGCTGG - Intergenic