ID: 1125063223

View in Genome Browser
Species Human (GRCh38)
Location 15:35449902-35449924
Sequence TGCAGATCTCTGAAATAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 348}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125063223_1125063228 19 Left 1125063223 15:35449902-35449924 CCTTGTTATTTCAGAGATCTGCA 0: 1
1: 0
2: 1
3: 35
4: 348
Right 1125063228 15:35449944-35449966 AGGTACATGATTTAGGCTTTGGG 0: 1
1: 0
2: 1
3: 7
4: 177
1125063223_1125063229 29 Left 1125063223 15:35449902-35449924 CCTTGTTATTTCAGAGATCTGCA 0: 1
1: 0
2: 1
3: 35
4: 348
Right 1125063229 15:35449954-35449976 TTTAGGCTTTGGGAACTCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 203
1125063223_1125063226 12 Left 1125063223 15:35449902-35449924 CCTTGTTATTTCAGAGATCTGCA 0: 1
1: 0
2: 1
3: 35
4: 348
Right 1125063226 15:35449937-35449959 TCAAATGAGGTACATGATTTAGG 0: 1
1: 0
2: 1
3: 16
4: 251
1125063223_1125063225 -1 Left 1125063223 15:35449902-35449924 CCTTGTTATTTCAGAGATCTGCA 0: 1
1: 0
2: 1
3: 35
4: 348
Right 1125063225 15:35449924-35449946 AAGGTAAACACTTTCAAATGAGG 0: 1
1: 0
2: 2
3: 32
4: 307
1125063223_1125063227 18 Left 1125063223 15:35449902-35449924 CCTTGTTATTTCAGAGATCTGCA 0: 1
1: 0
2: 1
3: 35
4: 348
Right 1125063227 15:35449943-35449965 GAGGTACATGATTTAGGCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125063223 Original CRISPR TGCAGATCTCTGAAATAACA AGG (reversed) Intronic
900079511 1:845139-845161 TGGAAATCCCTGAAAAAACATGG - Intergenic
900873631 1:5325117-5325139 AGCAGATCTGAGGAATAACAGGG + Intergenic
903345720 1:22682976-22682998 TGCACATCATTGAAATAACCAGG - Intergenic
903832845 1:26184839-26184861 TGCTCATCTCTAAAATAAGAAGG + Intronic
904633584 1:31861884-31861906 GGCAGTTCTATGAATTAACAGGG + Intergenic
904648338 1:31985539-31985561 TGAAGCTCTCTGTACTAACATGG + Intergenic
907749194 1:57246167-57246189 CGAAGATCTCTGAAATACCCTGG - Intronic
907803436 1:57794418-57794440 TAGAGACCTCTGAAAGAACATGG - Intronic
907808169 1:57841819-57841841 TGAAGATCTCTGAAATGCCTTGG + Intronic
907894836 1:58677931-58677953 TTCAGATATCTCATATAACATGG + Intronic
908663374 1:66462470-66462492 TGAAGATCTCTGAAATGCCCTGG - Intergenic
908932333 1:69331847-69331869 TGAAGATCTCTGAAATGTCCTGG + Intergenic
909096264 1:71292080-71292102 TTAAGATCTCTGAAATAATTAGG + Intergenic
909207338 1:72776049-72776071 TGCAGAGCTCTGAACAAAGAAGG - Intergenic
909251145 1:73357998-73358020 TGCAGATATATGTGATAACACGG + Intergenic
909257979 1:73448449-73448471 TGAAGATCTCTGAAATGCCCTGG + Intergenic
909323852 1:74324595-74324617 TACAGATCTCAGAAAGAAGAGGG + Intronic
909422803 1:75485037-75485059 TGTAGATCTCTGAAATGCCCTGG + Intronic
909521008 1:76567627-76567649 AGGATATCTCTGAAATACCAAGG - Intronic
909917748 1:81341093-81341115 AACATATCCCTGAAATAACATGG + Intronic
910047782 1:82938671-82938693 GGCATCACTCTGAAATAACATGG - Intergenic
910563598 1:88618830-88618852 TGAAGATCTCTGAAATACCCTGG + Intergenic
910899450 1:92104056-92104078 TGCAGCTTTCTGCAATAACCTGG + Intronic
911009410 1:93263176-93263198 TGAAGATCTCTGAAATGGCCTGG + Intronic
911590497 1:99742265-99742287 TGCTGATCCCTGAAATAAAAGGG + Exonic
911779562 1:101859065-101859087 CTCAGATCTCCTAAATAACATGG - Intronic
911829959 1:102537451-102537473 TGAAGATCTCTGAAATGCCCTGG + Intergenic
911982494 1:104583939-104583961 TGAAGATCTCTGAAATGCCCTGG + Intergenic
912113529 1:106373112-106373134 TGAAGATCTCTGAAATGTCCTGG + Intergenic
912735881 1:112149305-112149327 TGAAGATCTCTGAAATGCCCTGG - Intergenic
916163649 1:161944391-161944413 TGAAGAGCTCTGAACTGACATGG - Intronic
917220538 1:172723950-172723972 TTCAGGACTCTGAAATAACAGGG + Intergenic
918955850 1:191205893-191205915 TGAAGACCTCTGAAATACCCTGG - Intergenic
919007109 1:191911415-191911437 TGAAGATTTCTGAAATGCCATGG + Intergenic
922059826 1:222077874-222077896 TTCAGATCTTTTATATAACAGGG + Intergenic
923339199 1:232993666-232993688 TGAAGATCTCTGAAATGCCCTGG - Intronic
923889017 1:238190477-238190499 TGAAAATCTGTGAAGTAACATGG + Intergenic
924413390 1:243831292-243831314 AACAGATCTATGTAATAACAAGG + Intronic
1063317122 10:5017114-5017136 TGAAGGTCTCTGAAATACCTTGG + Intronic
1064637933 10:17387685-17387707 TGCAGATCTTTGAAATTATTAGG - Intronic
1066470607 10:35694043-35694065 TGCAAATCTCTGGATTATCATGG + Intergenic
1067778468 10:49179673-49179695 TTCAGAACTCAGGAATAACAGGG + Intronic
1068355875 10:55907541-55907563 TGAAGATCTCTGAAATGCCCTGG + Intergenic
1068986679 10:63114063-63114085 TGCAGATTTTAGAAATGACAAGG + Intergenic
1071209288 10:83318648-83318670 TGCAGATATTTGAAAGAACTTGG - Intergenic
1071262775 10:83935877-83935899 TGCTGATCTCTGATATAAGGTGG + Intergenic
1071859278 10:89656078-89656100 TGAAGGTCTCTGAAATGCCATGG - Intergenic
1072508496 10:96094053-96094075 TGCAGAACACAAAAATAACAGGG - Intergenic
1075833556 10:125432031-125432053 TGTAGGTCTGTGTAATAACAGGG + Intergenic
1075900281 10:126037720-126037742 TCCAGTTCTCTGAAACCACAGGG + Intronic
1076211980 10:128656375-128656397 TGGAGATCCCTGAAACAAAATGG - Intergenic
1077341165 11:2027028-2027050 TGCAGCTCACGGAAAGAACAGGG - Intergenic
1079228232 11:18626945-18626967 TTCAGATCTGTGAAAGAAAATGG + Intronic
1079622836 11:22575433-22575455 TCCAGATCTTTGAAATAATTCGG + Intergenic
1081032988 11:38110640-38110662 TGAAGATCTCTGAAATGCCTTGG - Intergenic
1081561948 11:44225863-44225885 TGCAGATCTCTGAGATAGCTTGG + Intronic
1082805792 11:57449108-57449130 TGGATATCTCTGGAAGAACATGG - Intergenic
1086357709 11:86021863-86021885 TACTGATATATGAAATAACATGG + Intronic
1087474376 11:98618292-98618314 TGAAGGTCTCTGAAATACCTTGG + Intergenic
1087577005 11:100001037-100001059 TGAAGATCTCTGAAATTCCATGG + Intronic
1088435284 11:109805173-109805195 TGAAGGTCTCTGAAATGACCTGG + Intergenic
1202824150 11_KI270721v1_random:82217-82239 TGCAGCTCACGGAAAGAACAGGG - Intergenic
1092583204 12:9870663-9870685 TGCTGATCTGTGCAAAAACATGG - Intergenic
1092724748 12:11474606-11474628 TGAAGATTTCTGAAATGTCAGGG - Intronic
1092900572 12:13055889-13055911 TGCAGATCTCTGGGAGGACAGGG - Exonic
1093265101 12:16993738-16993760 TGCAAATTTCTGAAAGAAGATGG - Intergenic
1093426378 12:19033067-19033089 TGAAGATCTCTGAAATGCCCTGG + Intergenic
1094667677 12:32537535-32537557 TGCACATCATTGAAAGAACAGGG - Intronic
1094768837 12:33629426-33629448 TGCAGATCCCTCAAATATGAAGG - Intergenic
1096557901 12:52415027-52415049 TGGAGATCTCTGAGATAAACTGG - Intergenic
1098836317 12:75428625-75428647 TGAAGATCTCTGAAATATCCTGG - Intronic
1098964839 12:76776969-76776991 TGCAGTTGTAAGAAATAACACGG + Intronic
1099470303 12:83040242-83040264 AGCATATCTTTGAAAGAACAAGG - Intronic
1100099104 12:91080748-91080770 TGGAGGTCTCTGTAATGACAGGG - Intergenic
1100230376 12:92600570-92600592 TGAAGATCTCTGAAATGCCCTGG + Intergenic
1100376045 12:94017355-94017377 TGAAGATCTCTGAAATGCCCTGG - Intergenic
1100597874 12:96087415-96087437 TGCAGATCTCTGACATGCCCTGG - Intergenic
1102631554 12:114285338-114285360 TGAAAATCTCTGACATAACCAGG - Intergenic
1104879489 12:132060611-132060633 TGGAGATATCTTAAAGAACAAGG + Intronic
1105758994 13:23495758-23495780 TTGAGATCTCTGAAGTTACATGG - Intergenic
1105834736 13:24199514-24199536 TGCTGATTTGTGAAATAATATGG + Intronic
1106877074 13:34085805-34085827 TATAGGTCTCTGTAATAACAGGG - Intergenic
1107023942 13:35780527-35780549 TGCACATATCTGAAGTAACTAGG - Intronic
1107049358 13:36030906-36030928 CGCAGAGGTCTGAAATAACAAGG - Intronic
1107398009 13:40038497-40038519 AGCAGATCTCTCTAATAACCGGG + Intergenic
1107521220 13:41183649-41183671 TTGAGATATCTGAAATACCAAGG - Intergenic
1108050732 13:46435575-46435597 TTCAGATGGCTGAACTAACAGGG - Intronic
1108490859 13:50979779-50979801 TTCATATCTTTGAAATAACTTGG - Intergenic
1108642892 13:52399081-52399103 TGAACATTTCTGAAATAACTAGG + Intronic
1108768341 13:53663281-53663303 TGAAGATCTCTGAAATGCCCTGG - Intergenic
1108770920 13:53699805-53699827 TGAAGATCTCTGAAATATCCTGG - Intergenic
1109174845 13:59142761-59142783 TGCAGTTCTCCGAAATCACTGGG + Intergenic
1109543308 13:63809199-63809221 TTCAGATGGCTGAACTAACAGGG - Intergenic
1109743751 13:66592290-66592312 TACTGATCTCTGAGTTAACAAGG - Intronic
1110902292 13:80837876-80837898 TGAAGGTCTCTGAAACAACTTGG + Intergenic
1111063132 13:83050503-83050525 TACTGATGTATGAAATAACATGG + Intergenic
1111241711 13:85482742-85482764 TGAAGGTCTCTGAAATACCTTGG + Intergenic
1111670884 13:91328568-91328590 TGCAGAAATCTGAATTAACAAGG - Intergenic
1112139302 13:96620813-96620835 TGCTGAACTCAGACATAACAAGG - Intronic
1112907075 13:104436212-104436234 TGAAGAGCTATTAAATAACATGG + Intergenic
1113148584 13:107236993-107237015 TGCAGTTCCCTGATATAAAATGG - Intronic
1115621346 14:35143588-35143610 TGCAGGTCTTTTAAATAATATGG + Intronic
1115719026 14:36139282-36139304 TGCTGATATGTGAAAGAACACGG + Intergenic
1115944368 14:38643530-38643552 TGAAGAGCTCTGAAATACCCTGG - Intergenic
1116123400 14:40750551-40750573 TGCATACCTCTGAAATGACAAGG - Intergenic
1116140325 14:40985308-40985330 TTCAGATCTTTGAAAAAAAAAGG + Intergenic
1116696344 14:48183080-48183102 TGAAGATCTCTGAAATATCCTGG - Intergenic
1116789685 14:49327309-49327331 TGAAGATCTCTGAAATGCCTTGG - Intergenic
1117562353 14:56954079-56954101 TCCAGTGCTCTGAAATACCATGG - Intergenic
1118083302 14:62387159-62387181 TGAAGATCTCTGAAATTCCCTGG - Intergenic
1119304186 14:73593823-73593845 TGAAGATCTCCCCAATAACATGG + Exonic
1120413746 14:84193683-84193705 TGAAGATCTCTGACATACCCTGG - Intergenic
1121369355 14:93342488-93342510 TGAGGATCTCTGAAATACCCTGG + Intronic
1121914080 14:97820385-97820407 TGAAGATCTCTGAAATGCCCTGG - Intergenic
1124904461 15:33855593-33855615 TGCAGATATCAGAAATACCTGGG - Intronic
1125063223 15:35449902-35449924 TGCAGATCTCTGAAATAACAAGG - Intronic
1125450943 15:39806614-39806636 GGAACATCTCTGAAAGAACAAGG - Intronic
1126217452 15:46172663-46172685 TGATGATCTCAGAAATAAGAAGG - Intergenic
1126758419 15:51946954-51946976 TGCAGGTCCCTGACATACCAAGG - Intronic
1127477960 15:59352382-59352404 TGCAGATCTGTGTTTTAACAAGG - Intronic
1127725805 15:61748493-61748515 TGCACATCTTTGACATGACATGG + Intergenic
1128190445 15:65689277-65689299 TCCAGATGTTTGAATTAACAAGG - Intronic
1131612919 15:93983898-93983920 TGCAGATGCCTGATATGACAGGG - Intergenic
1133782712 16:8952384-8952406 TTCAGAGCTGTGAAAGAACAAGG - Intronic
1133804520 16:9114538-9114560 TGCAGCTCTCTGAAATAGTGAGG - Intronic
1134796022 16:17037873-17037895 TGCAGATGTCTGAAGTCTCAAGG + Intergenic
1135018193 16:18941612-18941634 TGCACATCTCAGATTTAACATGG - Intergenic
1136645990 16:31615846-31615868 TGGAGATTTCTGAAAGAACTTGG + Intergenic
1137638505 16:50008514-50008536 TGAAGATCTCTGAAATATCCTGG - Intergenic
1138249831 16:55493207-55493229 TGCAGATCTCAGGAGTGACAGGG - Exonic
1139010718 16:62629759-62629781 TGCCAATATCTGGAATAACAAGG - Intergenic
1139761844 16:69190374-69190396 TGCAAATCCCTGAGATAAAAAGG - Intronic
1141200959 16:81897198-81897220 GCCAGCTCTCAGAAATAACAAGG - Intronic
1142728908 17:1837290-1837312 TGCAGATTACTGAATTAACATGG - Intronic
1148450578 17:47775253-47775275 TGCAGCCATCTGAAACAACAGGG - Intergenic
1154359836 18:13650460-13650482 TGCAGATCTCTGACATGATAGGG - Exonic
1155976380 18:32136158-32136180 AGCAGATCTCTCAAATATCTAGG + Intronic
1155979570 18:32166304-32166326 TGGAGAGCTCTGAAGTCACATGG + Intronic
1156507179 18:37605179-37605201 TCCAGACCTCTAAAAAAACATGG - Intergenic
1156696339 18:39772796-39772818 AGAAGATCCCTGAAAGAACAAGG + Intergenic
1157453092 18:47802423-47802445 AGCAGATACCTGAAATATCAGGG + Intergenic
1158471708 18:57742918-57742940 TGCTCATCTCTGAAATGTCAAGG - Intronic
1159130917 18:64279531-64279553 TGCTTATATCTGAAAAAACATGG - Intergenic
1159380690 18:67654177-67654199 TGCAGATATTTGAAGTAAGAAGG - Intergenic
1159393650 18:67828835-67828857 TGTAGTTCTCTGAAAAGACAAGG + Intergenic
1159451941 18:68613717-68613739 TGCAGATTTCTGAGATAGAAGGG - Intergenic
1160380077 18:78447860-78447882 TTCAGATTTCTGAAATAACTTGG - Intergenic
1166969143 19:46551269-46551291 TGCAGAACTCTGAAGCTACATGG - Intronic
1167732470 19:51268636-51268658 TGCAGATCTTTGTAATTCCAGGG - Exonic
925522208 2:4759814-4759836 TCCAAATCTATGAAAGAACAAGG - Intergenic
925722097 2:6839390-6839412 TGCAGATTTGTGAATGAACAGGG - Intergenic
925738053 2:6981160-6981182 TGAAGATCTCTGAAATGCCCTGG + Intronic
926363299 2:12110425-12110447 TTAAGGACTCTGAAATAACATGG - Intergenic
926409807 2:12591157-12591179 TACAGATCTCTCAAATGGCAGGG + Intergenic
926796363 2:16622355-16622377 TGAAGAGCTCTGAAATAAAAAGG + Intronic
927731502 2:25476796-25476818 TGAACATCACTGAAATGACAAGG + Intronic
928669165 2:33582743-33582765 TGCAGATTTCAGAACTATCAGGG + Intergenic
928749851 2:34458818-34458840 TGAAGATCTCTGACATACCTTGG - Intergenic
929376200 2:41289466-41289488 TGAAGACCTCTGAAATACCCTGG + Intergenic
929748072 2:44680029-44680051 AGCAAATGTCTGAAATAGCAGGG + Intronic
930387070 2:50710258-50710280 TGCAGCTTGCTGAAATATCAAGG - Intronic
930558535 2:52930113-52930135 TGTAGATCTCTGACATATCCTGG + Intergenic
933246086 2:79976239-79976261 TGCCTATCTCTGGTATAACAAGG + Intronic
936161759 2:110088814-110088836 TGAAGATCTCTGAAATGCCCTGG - Intronic
936182904 2:110282540-110282562 TGAAGATCTCTGAAATGCCCTGG + Intergenic
936394613 2:112112885-112112907 GGAAGAGCTCTGAAATAAAAGGG - Exonic
937491436 2:122371973-122371995 TGAAGATCTCTGAAATACCCTGG + Intergenic
939852876 2:147321194-147321216 TGAAGATCTCTGAAATGCCCTGG - Intergenic
939901466 2:147855368-147855390 TGCAGGTCTTTGATGTAACAGGG + Intronic
940121956 2:150276995-150277017 TGAAGATCTCTGAAATGCCTTGG + Intergenic
940271266 2:151893082-151893104 CGCAGATCAATGAAATTACAAGG + Intronic
940499614 2:154477861-154477883 TGAAAATCTCTGAAATACCCTGG - Intergenic
940516729 2:154692975-154692997 TGCTGATTTATGAAATAATAAGG - Intergenic
940597920 2:155818831-155818853 TGAAGATCTCTGAAATGCCCTGG - Intergenic
940777030 2:157895510-157895532 GGCATTTCTCTGAAATAAAAAGG - Intronic
940788020 2:158002699-158002721 TGCTGATCTCTGAAAGACAAAGG - Intronic
942825474 2:180169887-180169909 TGAAGATCTCTGAAATGCCCTGG + Intergenic
943090685 2:183371170-183371192 GGCAGATTTCTGAAACAACAGGG - Intergenic
943108056 2:183571868-183571890 TGAAGACCTCTGAAATACCCTGG - Intergenic
943313181 2:186353202-186353224 TGAAGATCTCTGACATGCCATGG - Intergenic
943450957 2:188041369-188041391 TGCAGTTCTTAGAAATTACAGGG - Intergenic
944470368 2:200046122-200046144 TGAAGATCTCTGAAATGCCCTGG + Intergenic
945826999 2:214733065-214733087 TGCAGATCTTTAAAACAAGAAGG - Intronic
946544027 2:220716549-220716571 TGAAGATCTCTGAAATTTCCTGG + Intergenic
948075839 2:235164602-235164624 AGCAGATCCCTGAAATAGGATGG - Intergenic
1168809348 20:694067-694089 AGCAGATCTGTGAACTAACCGGG + Intergenic
1169381042 20:5107384-5107406 TGCAGCTCTGAGAAATAAAAGGG + Intronic
1173441627 20:43082597-43082619 TGGAGATGTCTGAAAAAACAGGG - Intronic
1175467029 20:59196213-59196235 AGCAAATCTTTGAAATAACTGGG + Intronic
1177171967 21:17665025-17665047 TGCAGAGCTATGAAAAGACATGG + Intergenic
1177641156 21:23845937-23845959 TGAAGATCTCTGAAATGCCCTGG + Intergenic
1179198974 21:39196634-39196656 TGAAAATCTCTGAAACAACTGGG - Exonic
1180583188 22:16860643-16860665 TGCAGCTCTCAGAACTAAAAAGG - Intergenic
1181905736 22:26194371-26194393 TGCAGATCTTTGTTATAACTAGG + Intronic
1183435156 22:37789638-37789660 TCCAGGTGTCTGAAATACCAAGG + Intergenic
1183824545 22:40374918-40374940 AGCATATGACTGAAATAACAAGG + Intronic
949428712 3:3948692-3948714 TCCAGATATTTGAAAGAACATGG + Intronic
950154777 3:10713349-10713371 TGCAGTTTTCTGACATGACAAGG - Intergenic
950355250 3:12402881-12402903 TGCAAGTCTCTGATATAAAATGG + Intronic
950794276 3:15497945-15497967 TGAACTTCTCTGAAAGAACATGG + Intronic
952355962 3:32584250-32584272 TGCATATCTTTAAAAAAACAAGG + Intergenic
953017553 3:39092729-39092751 TGGAAATCTCTGTAATAAAAAGG - Intronic
953095791 3:39775602-39775624 TGCTTATTTCTGAAATTACAGGG - Intergenic
954863800 3:53712196-53712218 TGCAGATCTCAGAAAGACAATGG - Intronic
955845800 3:63161525-63161547 GGCAGATCTTTGAAATCACTTGG + Intergenic
957179179 3:76854608-76854630 TGCAGAAATCTGAAACAAGAAGG - Intronic
957247814 3:77735504-77735526 TGCAGATCTGGGAATTAAAAAGG - Intergenic
958710174 3:97708643-97708665 TGAAGATCTCTGAAATGCCCTGG - Intronic
959023370 3:101213859-101213881 TGAAGATCTCTGAAATGCCCTGG - Intergenic
959160976 3:102724426-102724448 TGAAGATCTCTGACATGACCTGG - Intergenic
959341862 3:105141629-105141651 TGAAGATCTCTGCAATATCAAGG + Intergenic
959471632 3:106759173-106759195 TGCATCTCTCTAAATTAACAAGG - Intergenic
959600009 3:108171238-108171260 TGCTTATCTGTGAAATGACAAGG - Intronic
960176847 3:114527371-114527393 TTCAGCCCTGTGAAATAACATGG - Intronic
960407713 3:117282460-117282482 TCCAAATATATGAAATAACAAGG - Intergenic
960502380 3:118453943-118453965 CTCAGATGGCTGAAATAACAGGG - Intergenic
960554066 3:119008199-119008221 TGGAGATTTCTGAAATAATCTGG - Intronic
960727686 3:120687023-120687045 TGCAGTTTTCTCAAATAACAGGG + Exonic
961029758 3:123591214-123591236 TGAAGATCTCTGAAATTCCCTGG + Intergenic
963572467 3:147015500-147015522 TGAAGGTCTCTGAAATACCCTGG - Intergenic
963616451 3:147544419-147544441 TACAGATCACTCAAATGACATGG + Intergenic
964092458 3:152892725-152892747 TGGAGATCTCTGAAATGCCTTGG + Intergenic
964513618 3:157480845-157480867 TGAAGATTTCTCAAAGAACAAGG - Intronic
964840863 3:160992150-160992172 TGCATATTTAAGAAATAACAAGG + Intronic
965157003 3:165073870-165073892 TTCAAATCTCTCAAATAAAATGG - Intronic
965234033 3:166091460-166091482 TGAAGATCTCTAAAATACCCTGG + Intergenic
966274339 3:178146644-178146666 CTCTGATCTCTGACATAACATGG - Intergenic
967195258 3:187020638-187020660 TGCAGATTTCTGAGAAAAGAGGG - Intronic
970049472 4:11897515-11897537 TGAAGATCTCTGACATACCCTGG - Intergenic
970218112 4:13780004-13780026 TGAAGATCTCTGACATAGCCTGG + Intergenic
970254950 4:14158076-14158098 TTCAGATTTCTGGAGTAACATGG + Intergenic
970644053 4:18098939-18098961 ACCAGATCTCTCAAATGACATGG + Intergenic
970887165 4:20999862-20999884 TGCAAAGCTCTGAAACAAGAAGG + Intronic
972885028 4:43475507-43475529 TTCAGATATCTGAAACAACTTGG + Intergenic
973032336 4:45360419-45360441 TGAAGTTCTCTGAAATGCCATGG - Intergenic
973131591 4:46654289-46654311 TGGAGATCTCTGAAATGCCTTGG + Intergenic
974267428 4:59603399-59603421 TGAAGATCTCTGAAATGCCCTGG - Intergenic
974544538 4:63283629-63283651 TGCTGTTTTCTCAAATAACAAGG + Intergenic
974640995 4:64630620-64630642 TGGAGATTACTGAAAAAACATGG + Intergenic
974914522 4:68163012-68163034 TGCAGAGCCCTGAAATAAAGTGG + Intergenic
976503187 4:85815195-85815217 TGAAGACCTCTGACATAACTTGG + Intronic
976604384 4:86969073-86969095 TGCAGATTCCTGAAGGAACAAGG - Intronic
976949846 4:90814353-90814375 TGAAGATCTCTGAAATGACCTGG + Intronic
977435405 4:96989088-96989110 TGAAGATCTCTGAAATGCCCTGG - Intergenic
977518734 4:98055345-98055367 TGAAGATCTGTTAAAAAACATGG - Intronic
978333778 4:107644357-107644379 TGCCTATCTCTGAAAACACAAGG + Intronic
978492502 4:109323628-109323650 TGAAGATCTCTGAAATGTCCTGG + Intergenic
978606920 4:110490710-110490732 TGCAGTACTCTGAAATATTATGG + Intronic
978730862 4:112024924-112024946 TACAAATATCTTAAATAACAGGG + Intergenic
979002004 4:115233291-115233313 CCCAGATCCCTGAAATAAAATGG - Intergenic
979574861 4:122277849-122277871 TACAGATCTCTAAAATAAGGTGG + Intronic
979750747 4:124275858-124275880 TGCATATCACTCAAATAACATGG - Intergenic
980165709 4:129224453-129224475 TACAGATCCCTGATATAACCAGG - Intergenic
980168005 4:129252127-129252149 TGAAGATCTCTGAAATGCCCTGG - Intergenic
980247514 4:130266940-130266962 TGAAGATCTCTGAAATGCCCTGG - Intergenic
981191789 4:141872671-141872693 TGAAGATCTCTGAAATGCCTTGG + Intergenic
982346608 4:154367172-154367194 TGCAGGTCTCTGGAAGGACATGG + Intronic
982439311 4:155416399-155416421 TTCAGATCTGTGAAATGGCATGG + Intergenic
982478425 4:155879608-155879630 TGAAGATCTCTGACATGCCATGG + Intronic
983975119 4:173924693-173924715 TGCAGATCTCTGATAAGACTAGG + Intergenic
984436767 4:179719167-179719189 TGAAGTTCTCTGACATAACCTGG + Intergenic
985034063 4:185820692-185820714 TACAGAACTCTTAAAGAACACGG - Intronic
985371694 4:189292119-189292141 TGAAGATCTCTGAAATGCCCTGG - Intergenic
986498016 5:8366370-8366392 TGCAAGTTTCTGAAATAGCAGGG + Intergenic
986538278 5:8815613-8815635 CGAAGATCTCTGAAATACCCTGG - Intergenic
986960658 5:13206866-13206888 TGCATATATCTCAAAGAACAAGG - Intergenic
987481397 5:18463280-18463302 TCCAGTTATCTGAAGTAACATGG + Intergenic
987894396 5:23925857-23925879 TGAAGATCTCTGACATAGCCTGG + Intergenic
988227045 5:28426228-28426250 TGAAGATCTCTGACATGACCTGG - Intergenic
988612239 5:32737592-32737614 TGGAGAGCTCTGAAAATACAAGG - Intronic
988857668 5:35245046-35245068 TGCTGATCCCTGGAATATCAGGG + Intergenic
989970614 5:50520559-50520581 TCCAGATATTTGAAAGAACATGG + Intergenic
990917209 5:60921360-60921382 AGCAGACCTTTGAATTAACAGGG - Intronic
991081226 5:62602188-62602210 TGAAGATCTATAAAATAATAGGG - Intronic
991384125 5:66065555-66065577 TGAAAATCTCTGAAATCACTCGG - Intronic
992969683 5:82043404-82043426 TGAAGATCTCTAAAATACCCTGG + Intronic
993084648 5:83348634-83348656 TGAAGATCTCTGAAATGCCTTGG + Intronic
993095985 5:83478607-83478629 TGCAGCTGTCAAAAATAACATGG + Intronic
993249495 5:85500416-85500438 TGCAGACATCTAAAATAATAAGG - Intergenic
994008791 5:94875439-94875461 GGCAGGTCTCTGAAAAAACTTGG + Intronic
995314693 5:110755407-110755429 TCCAGATGTTTTAAATAACATGG + Intronic
995701314 5:114938965-114938987 TGAAGATCTCTGAAATGCCCTGG - Intergenic
995779852 5:115763197-115763219 TGAAGATCTCTGAAATGCCCTGG + Intergenic
995918404 5:117279449-117279471 CGCAGACATCTGAAATCACAGGG + Intergenic
996453750 5:123656527-123656549 TGAAGATCTCTGAAATGCCCTGG + Intergenic
997193341 5:131960519-131960541 TGCAGATCTCTGCACAAATAAGG - Exonic
998569712 5:143246280-143246302 AGCAGAGCTCTGTAATAACGGGG + Intergenic
998876364 5:146604283-146604305 TGCACATCTCTGATATTGCAGGG - Intronic
999293870 5:150445761-150445783 TGCAGACCTCTGAACTAGCGGGG - Intronic
1000103070 5:158035401-158035423 TGAAGATCTCTGAAATGCCATGG - Intergenic
1000575113 5:162967017-162967039 TGAAGATCTCTGAAATGCCCTGG + Intergenic
1000575369 5:162969578-162969600 TGAAGATCTCTGAAATACCCTGG - Intergenic
1001194941 5:169663826-169663848 TGAAGATCTCTGAAATGCCCTGG + Intronic
1003295207 6:4820241-4820263 TTCAGAGCCCTGAAATAACAGGG - Intronic
1003337056 6:5183833-5183855 TGCAGATCTATTGTATAACATGG + Intronic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1005169619 6:22967987-22968009 TTCAGATCTCTAAATTATCAAGG - Intergenic
1005543231 6:26835739-26835761 TGAAGATCTCTGAAATGCCCTGG - Intergenic
1008137354 6:47792384-47792406 TCCTTATCTCTGAAATCACAGGG - Intronic
1008516372 6:52323229-52323251 TGGAGATCTCTAAACTCACAGGG + Intergenic
1009014058 6:57877904-57877926 TGAAGATCTCTGAAATGCCCTGG - Intergenic
1009619995 6:66063538-66063560 TGAATATCTCTGAAATACCCTGG - Intergenic
1009791258 6:68403940-68403962 TGAAGATCTCTGAAATGCCCTGG + Intergenic
1011335956 6:86259898-86259920 TGCATATTTCTGAAACAGCAGGG - Intergenic
1011698659 6:89935315-89935337 TGCAGATTTCTGTACTAAAAGGG - Intronic
1011810413 6:91126116-91126138 TGCAAATCCCTGAAATAAAATGG - Intergenic
1011955988 6:93025848-93025870 TGAAGATCTCTGAAATGCCCTGG + Intergenic
1012657108 6:101838063-101838085 TCCTTATCTCTGAAATCACAGGG + Intronic
1015088321 6:129323769-129323791 TGCAGCTCTCTGCAGTAATACGG + Intronic
1015689596 6:135907003-135907025 TGAAAATCTCTGAAATGACATGG + Intronic
1016126262 6:140408199-140408221 TGAAGGTCTCTGAAATGCCATGG - Intergenic
1016840581 6:148520412-148520434 TGCACATCACAGAAATGACAAGG - Intronic
1017412559 6:154184387-154184409 TGCAGTTATCAAAAATAACAAGG + Intronic
1018592686 6:165443883-165443905 TGAAGATCTCTGAAATGTCCTGG + Intronic
1018640802 6:165902246-165902268 TGCAGATCTCTGAGAAACAAGGG - Intronic
1020979841 7:15053514-15053536 TGAAGATCTCTGAAATGCCCTGG + Intergenic
1021109715 7:16679616-16679638 TTCAGATCTCTGGATTAAAAGGG - Intronic
1021617650 7:22519701-22519723 TGAAGATCTCTGAAATGCCCTGG - Intronic
1022823258 7:33982090-33982112 TGCAGTTCTCTGCAATAGGAAGG + Intronic
1022927244 7:35069191-35069213 TGAAGATCTCTGAAATGCCCTGG - Intergenic
1024415214 7:49097751-49097773 TGAAGATCTCTGAAATGCCTTGG - Intergenic
1024624055 7:51188934-51188956 TTCAGGTATCTGAAATAAAAAGG - Intronic
1024684970 7:51734858-51734880 TGAAGATCTCTGAAATTTCATGG + Intergenic
1024711123 7:52015834-52015856 TGCAGAAATCTTAAACAACAGGG - Intergenic
1028067087 7:86399962-86399984 TGCAGTTGTCTGAAATAACATGG + Intergenic
1030565326 7:111146992-111147014 AGAAGAGCTCTGAAATAAAATGG - Intronic
1031020782 7:116625506-116625528 TGCAGACCTCTGGAATCACTGGG - Intergenic
1031127071 7:117786947-117786969 TGCAGACCTCTAAAAAAATAAGG - Intronic
1031437913 7:121755684-121755706 CACACATTTCTGAAATAACAAGG - Intergenic
1031668864 7:124518776-124518798 TGAAGATCTCTGAAATGCCCTGG - Intergenic
1035525994 8:313780-313802 TGGAAATCCCTGAAAAAACATGG + Intergenic
1036280232 8:7394015-7394037 TGCACAGCTCTGAAAACACAGGG - Intergenic
1036341293 8:7917868-7917890 TGCACAGCTCTGAAAACACAGGG + Intergenic
1037215236 8:16442996-16443018 TGCAGATTTTTGACCTAACAGGG + Intronic
1037341498 8:17850238-17850260 TGCTGATCTCTGAGTCAACATGG + Intergenic
1038123126 8:24641054-24641076 TGCAGATCTGTGAAGTTAAATGG + Intergenic
1038969333 8:32614500-32614522 TGATGATCTCTGAAAAAAAAAGG - Exonic
1042938633 8:74085669-74085691 TGCAAATCTCTGAAATAGAAAGG - Intergenic
1043065779 8:75568155-75568177 TGAAGATCTCTGAAATGCCCTGG + Intergenic
1043276919 8:78409014-78409036 TTAATATCTCTGAAATAAGAAGG - Intergenic
1045910685 8:107405031-107405053 TGAATATGTCTGATATAACATGG - Intronic
1046086306 8:109440027-109440049 TTCAGATTTAAGAAATAACAAGG + Intronic
1046353700 8:113049598-113049620 TGAAGATCTCAGAAACAAAAGGG + Intronic
1047198350 8:122742173-122742195 TGTGGATCTCTGAAAACACACGG + Intergenic
1047648980 8:126899779-126899801 TGAAGATCTCTGAAATGCCCAGG - Intergenic
1048011225 8:130457891-130457913 TGGAGATCCCTGAAATAACTGGG - Intergenic
1048581581 8:135733483-135733505 AGCAGAGCTCTGGAATCACATGG - Intergenic
1050795225 9:9531298-9531320 TTCAGCTCTCAGAAATGACATGG + Intronic
1050967903 9:11832090-11832112 TACAGATCTCTGAAAACAGATGG + Intergenic
1052168097 9:25357992-25358014 TGAAGATCTCTGAAATGCCCTGG + Intergenic
1053619602 9:39802152-39802174 TGAAGATCTCTGAAATGCCCTGG - Intergenic
1053874602 9:42530140-42530162 TGAAGTTCTCTGAAATATCTTGG + Intergenic
1053877771 9:42561468-42561490 TGAAGATCTCTGAAATGTCCTGG - Intergenic
1053894884 9:42732898-42732920 TGAAGATCTCTGAAATGTCCTGG + Intergenic
1054233922 9:62540226-62540248 TGAAGATCTCTGAAATGTCCTGG + Intergenic
1054264556 9:62905291-62905313 TGAAGATCTCTGAAATGCCCTGG + Intergenic
1054267732 9:62936615-62936637 TGAAGTTCTCTGAAATATCTTGG - Intergenic
1054854869 9:69888034-69888056 GGCAGATATCTCAAATAAAAAGG + Intronic
1055821459 9:80269719-80269741 TGCAGTTCTCTGAAAGACAATGG - Intergenic
1057194832 9:93111141-93111163 TGCAGATCGCTGCAATGAAAGGG - Intronic
1058562474 9:106244576-106244598 TCCAGATTACTGAAAGAACACGG - Intergenic
1059046216 9:110870494-110870516 TGCAGTTCTAAGAAATAATATGG - Intergenic
1060117336 9:120952548-120952570 TGTAACTTTCTGAAATAACATGG - Exonic
1188297438 X:28466889-28466911 TCCCCATCTCTGAAATATCAGGG + Intergenic
1188690900 X:33127899-33127921 TGCAAATCACTGAAATAAGAAGG - Intronic
1189063492 X:37780607-37780629 TTTAGATCTCTGAAAAAAGAAGG - Intronic
1189586772 X:42469883-42469905 AGGAGATCTGAGAAATAACAGGG + Intergenic
1189731482 X:44025531-44025553 GGCAGCTCCCTGAAATCACATGG - Intergenic
1189869624 X:45368807-45368829 TGAAGATCTCTGAAATGCCCTGG - Intergenic
1192680071 X:73242861-73242883 TCCAGATATCTGAAAAAACTTGG - Intergenic
1194062388 X:89220443-89220465 TCCAAATATCTGAAATAATAAGG + Intergenic
1194150869 X:90323732-90323754 TGAAGATCTCTGAAATAAATTGG + Intergenic
1194595295 X:95849126-95849148 TCCAGATATTTGAAATAACTTGG - Intergenic
1195815326 X:108878532-108878554 TGAAGATCTCTGAAATGCCCTGG + Intergenic
1196759495 X:119188707-119188729 TGCAGTTGTCAGAAATAATACGG - Intergenic
1197075099 X:122343836-122343858 TGTAGATCTCTGAAATACCCTGG + Intergenic
1197075939 X:122352082-122352104 TTCAGATATTTGAAATAACTTGG - Intergenic
1197428728 X:126331531-126331553 TGGAGATTTCTCAAAGAACAGGG - Intergenic
1198944176 X:141991491-141991513 TGAAGATCTCTGAAATGCCCTGG - Intergenic
1199111821 X:143944632-143944654 TGCAGATCTTTGGAATTTCAAGG - Intergenic
1199378519 X:147141043-147141065 AGCCAATCTCTGAAATAGCAAGG - Intergenic
1200318127 X:155156094-155156116 TGCAAGTCTCTGATATAAAATGG + Intergenic
1200497237 Y:3900493-3900515 TGAAGATCTCTGAAATAAATTGG + Intergenic
1200716257 Y:6549411-6549433 TCCAAATATCTGAAATAATAAGG + Intergenic
1200921158 Y:8614712-8614734 TGCAGACCTCTGAAAGAAGTGGG - Intergenic