ID: 1125065430

View in Genome Browser
Species Human (GRCh38)
Location 15:35479199-35479221
Sequence CTGTGTGACCAGAGGAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125065430 Original CRISPR CTGTGTGACCAGAGGAAAAC TGG Intronic
902238677 1:15074073-15074095 CTGTGTGACCACAGCCAAGCTGG + Intronic
902395245 1:16128910-16128932 CTGTGTGACCTCAGGCAAGCCGG + Intronic
902661221 1:17905388-17905410 CTGTCTGTCCAGGGGAAAATAGG + Intergenic
903346680 1:22689598-22689620 CTGTGTGACTCATGGAAAACAGG + Intergenic
903467040 1:23559016-23559038 CTGTCTGATTAGAGGAAAAGAGG + Exonic
903541445 1:24098630-24098652 CTGAGTGACCAGGGGCAAAAAGG - Intronic
904366243 1:30012598-30012620 GGCTGTGACCAGAGTAAAACAGG - Intergenic
906216148 1:44041608-44041630 CTGGGTGACAAGAGCAAAACTGG + Intergenic
907921823 1:58921187-58921209 CTGTGCATCCAGAAGAAAACAGG - Intergenic
908030832 1:59997608-59997630 CTGTGTGATCTGAGTAACACAGG - Exonic
908602201 1:65752612-65752634 GTGTATGCACAGAGGAAAACAGG - Intergenic
909235693 1:73150706-73150728 CTGTGGGAACAGAGTAAATCAGG - Intergenic
910634954 1:89397432-89397454 CTGAGTGACCAAAGCAAAAATGG - Intergenic
916929130 1:169556680-169556702 CTGTGGGCCCAGAGGGAAAGTGG - Exonic
917647301 1:177041762-177041784 CTTTATGATCAGAGAAAAACAGG - Intronic
918687290 1:187433668-187433690 CTGTGGAACAAGAAGAAAACTGG + Intergenic
919159742 1:193813395-193813417 CAGTGTGAAAAGAGGAAAAGAGG + Intergenic
919873374 1:201841893-201841915 GTGTGAGAGCAGAGGAAAAATGG - Intronic
923222086 1:231904512-231904534 CTGTGTTATGAGAGTAAAACTGG + Intronic
924198554 1:241637043-241637065 CTGTGTGGCCAGAGGTAGAAAGG + Intronic
924423191 1:243928493-243928515 CTTGGTTACCAGAGGAAAATGGG + Intergenic
1062886024 10:1016579-1016601 CAGTCAGACCTGAGGAAAACAGG + Intronic
1063889610 10:10616119-10616141 ATGTGTGACCAGAGGCTGACAGG + Intergenic
1064068237 10:12202364-12202386 GTGTGAGAGCAGAGGAAAAACGG - Intronic
1067749185 10:48958672-48958694 CTGTGTGAGGATAGGAAAAATGG + Intronic
1070419037 10:76218191-76218213 CTGTGTGCACTGAGGAAAAGAGG + Intronic
1070634755 10:78116385-78116407 CTGTGTGGCCAGAGGACTTCGGG - Intergenic
1075353178 10:121744741-121744763 CTGTGTACCCTGAAGAAAACCGG - Intronic
1076988510 11:256869-256891 CTGTGAGGCCAGAGGAAGAAGGG + Intergenic
1077517829 11:3012564-3012586 GTGTCTGACCTGAGGAAAGCAGG - Intronic
1078048564 11:7940897-7940919 CTGTGGGACAAGAGGAAGCCAGG + Intergenic
1078614778 11:12854961-12854983 ATGTGTGACCAGTGGATGACTGG + Intronic
1079280152 11:19079897-19079919 CTGTGTGTTTAGAAGAAAACAGG - Intergenic
1079607769 11:22391372-22391394 CTGTGTGACCACACATAAACAGG + Intergenic
1080062098 11:27967803-27967825 GTTGGTGAGCAGAGGAAAACAGG + Intergenic
1081613651 11:44578196-44578218 CTGGGTGTCCAGAGGAAAAGGGG - Intronic
1082873209 11:57962552-57962574 CTGTGTGATCAGAAGAAAATTGG - Intergenic
1085822922 11:79812189-79812211 CTGTGTGACCATGGAAAACCCGG + Intergenic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1089491483 11:118886859-118886881 CAGTGTGACCAGAGCATCACAGG + Intronic
1090174836 11:124639271-124639293 CTGTGAGGCCAGAGGAATGCTGG + Intronic
1091912394 12:4242958-4242980 CATTGAAACCAGAGGAAAACAGG - Intergenic
1092179254 12:6434245-6434267 CTATGAGACCAGAAGAAGACAGG + Intergenic
1092217988 12:6695652-6695674 CTGGGGTACCAGAGGAAAAGAGG + Intronic
1093927162 12:24920539-24920561 GTGTGAGAGCAGAGGAAAAATGG - Intronic
1095192100 12:39269943-39269965 ATGTGTAACTGGAGGAAAACTGG - Intergenic
1095393652 12:41739306-41739328 CTGGGTGACTAGAAAAAAACAGG + Intergenic
1096749010 12:53747099-53747121 CTGAGTGACCCTAGGAATACAGG - Intergenic
1100913527 12:99391826-99391848 ATGTGACACCACAGGAAAACAGG + Intronic
1102175581 12:110871592-110871614 CTCTGTCACCAGAGCAAGACTGG + Intronic
1102707194 12:114892302-114892324 GTGCGTGACCACAGGAAAGCTGG + Intergenic
1102820513 12:115905392-115905414 TTGTGTGTCCAGAGCAAAATGGG + Intergenic
1104907523 12:132221752-132221774 CTCTGTGATCAGAGGAATTCGGG + Intronic
1105329398 13:19401019-19401041 CTGAGAAACAAGAGGAAAACTGG + Intergenic
1105723119 13:23135472-23135494 GTTTGTGAACAGAGGAAAAATGG - Intergenic
1105862459 13:24428249-24428271 CTGAGAAACAAGAGGAAAACTGG - Intronic
1107159765 13:37211894-37211916 ATCTGTGACAAGAGGAAAAGGGG - Intergenic
1109319510 13:60792614-60792636 CTGTGGGACCAGAGTGAAATGGG - Intergenic
1114739872 14:25084706-25084728 CGCTATGACCAGAGGAAAAGGGG + Intergenic
1121808587 14:96857226-96857248 CTGTGGAACTAGAAGAAAACAGG + Intronic
1123780925 15:23627591-23627613 CTGTGTGCCCAAGAGAAAACAGG - Intronic
1125065430 15:35479199-35479221 CTGTGTGACCAGAGGAAAACTGG + Intronic
1128268706 15:66290329-66290351 CTCTGTGCCCAGAGAAAAAGAGG + Intergenic
1130959489 15:88650287-88650309 CTGTGTGACCAGAGCAGGGCAGG + Intronic
1133983104 16:10648155-10648177 CTGTGTAAGCAGAGGAACAAGGG + Intronic
1134804730 16:17114546-17114568 GTGTGAGAGCAGAGGAAAAGTGG + Intronic
1134847515 16:17452525-17452547 AACTGTGCCCAGAGGAAAACTGG - Intronic
1135245045 16:20848459-20848481 CTATGTGACCCTAGGAAAATTGG - Intronic
1135421634 16:22309065-22309087 CTGTGTGAACGCAGGGAAACCGG - Intronic
1136543433 16:30942005-30942027 CTGTGTGGCCAGAAGAGAGCTGG + Intronic
1138270699 16:55693896-55693918 CTCTGAGACCAGAGGAAACATGG - Intronic
1139541057 16:67616782-67616804 CTTTGTGACCAGTGGAGAATTGG + Exonic
1141036401 16:80630067-80630089 CTGTGTGAGAGGAGGAATACAGG - Intronic
1141405983 16:83793551-83793573 TTGTGTTCCCAGAGGAAAAAAGG - Intronic
1141492444 16:84383236-84383258 CTGTGTGTCTAGAGGCAGACAGG + Intronic
1143178904 17:4972372-4972394 CTGGGACACCAGAGGAAAGCTGG + Exonic
1144210547 17:13011390-13011412 CTGTTTTCCCAGAGGAGAACAGG - Intronic
1148139655 17:45318998-45319020 TGGTGTGCCCAGAGGCAAACAGG - Intergenic
1148464137 17:47854837-47854859 GTGAGTGAGAAGAGGAAAACAGG - Intronic
1151041361 17:70864435-70864457 GTTTGTGTCCAGAAGAAAACTGG + Intergenic
1155189420 18:23416184-23416206 TTGTGTGATAAGAGCAAAACAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156291886 18:35754823-35754845 CTGAGTTGCCAGAGGAAGACTGG + Intergenic
1157161877 18:45321055-45321077 CTGTGTAAACACAAGAAAACAGG - Intronic
1158523170 18:58188617-58188639 CTGTGGGACCAGAGCAACACAGG - Intronic
1160993034 19:1868422-1868444 CAGTGTGACCTCAGGAAGACAGG + Intergenic
1161494072 19:4578140-4578162 GTGTGTGACCATAGGAACCCAGG - Intergenic
1165002448 19:32776171-32776193 CTATCTGGCCAGAGGAATACGGG - Intronic
1165810635 19:38609753-38609775 CTGTGTGCCCAGAGGGTTACAGG - Intronic
1165903827 19:39181488-39181510 CTGTGTGGCTAGAGGAACAGAGG + Intronic
1166400555 19:42476248-42476270 ATTTGTGACCACAGGAAAAAGGG - Intergenic
1167271064 19:48506609-48506631 CTGTGTGTCCTCAGGAGAACAGG + Intronic
1167765567 19:51480016-51480038 GTGTTTGAGCAGAGGAGAACAGG + Intronic
925636426 2:5945651-5945673 CAGTGAGTCCTGAGGAAAACAGG - Intergenic
925655756 2:6146460-6146482 CTCTGTCACCAGAGAAAAACTGG - Intergenic
925844170 2:8020591-8020613 CTGTGGGACCAGAGGAGAACTGG + Intergenic
927127322 2:20023975-20023997 CTGTCTGGCCAGAGGAATAGTGG - Intergenic
928200138 2:29242649-29242671 CTGTGTGACCTGAGGCAACATGG + Intronic
929193517 2:39162368-39162390 TTGGGTGACCAGAGGACAACAGG - Intergenic
931110122 2:59101269-59101291 CAGTGTGGCTAGAGTAAAACAGG - Intergenic
931113366 2:59137526-59137548 TTGTGTGAACAGAAGAAAAGGGG + Intergenic
932728969 2:74204255-74204277 ATGTGTGAAAATAGGAAAACTGG + Intronic
934053334 2:88228763-88228785 CTCTGTGACTATAAGAAAACTGG - Intergenic
935638847 2:105271569-105271591 CTGTGTGACCTGTGGCAAGCGGG + Intronic
938247625 2:129791316-129791338 CTGTGGGACCAGAGGTGGACTGG - Intergenic
939953991 2:148509656-148509678 CTGTGTGATCAGAGGAAGGGCGG - Intronic
940176484 2:150882931-150882953 CTGAGTGTCTAGAAGAAAACAGG - Intergenic
940348471 2:152653261-152653283 CTCTAAGACCAGAAGAAAACCGG + Exonic
941270365 2:163419020-163419042 GTGTGAGATCAGAGGAAAATGGG + Intergenic
942623892 2:177878097-177878119 CTGTGTGACCAGATGAATGTAGG + Intronic
946161607 2:217839191-217839213 CCGTGTGGCCAGAGGAAGAAAGG + Intronic
946345328 2:219105328-219105350 CTGTCTGGCCAGTGGAAATCTGG - Intronic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
1168842254 20:916962-916984 CTGTGTCTCCAGAGGCAAAGTGG - Intergenic
1169482841 20:6000967-6000989 CTGCAGGACCAGAGGGAAACAGG + Intergenic
1171532595 20:25862284-25862306 GTGTGTCACCGGAGGCAAACCGG + Intronic
1172944787 20:38678789-38678811 CTGTGTGACCACAGGATACAGGG + Intergenic
1173792575 20:45837235-45837257 CAGTGTGTCCTGAAGAAAACTGG + Intronic
1174225686 20:48997777-48997799 CTGTGTGACCAGAGATCATCTGG + Intronic
1174385691 20:50187499-50187521 CTGTGTGGGCACAGGAAACCAGG - Intergenic
1174385865 20:50188465-50188487 CTGTGTGACCTTAGGCAAAATGG - Intergenic
1175459810 20:59144005-59144027 CTGTGTGAACAGAGTTAAATGGG - Intergenic
1175925588 20:62469830-62469852 CTGCGGGACCAGAGGAAACTGGG + Intronic
1176205217 20:63884551-63884573 CTGTGCTTCCAGAGAAAAACAGG - Intronic
1176221732 20:63972531-63972553 CTGTGTGACCCGAGGAGGAAGGG + Intronic
1177489592 21:21805179-21805201 CTGTGTGACTAGAATAAAGCAGG + Intergenic
1181169662 22:21001074-21001096 CTGTGACACAAGGGGAAAACAGG - Intronic
1182416522 22:30224814-30224836 CTGAGTGACCAGAGCAAAGCTGG + Intergenic
1183484995 22:38083905-38083927 CCCTGTGACAAGAGGACAACAGG - Intronic
1184334252 22:43844134-43844156 GTGTGAGAGCAGAGGAAAAGCGG + Intronic
950168748 3:10821467-10821489 AAGTGTAACCAGAGGAAAATGGG + Intronic
950874923 3:16263176-16263198 CAGTGTGACCAGAGCAGAGCAGG - Intronic
950976550 3:17252364-17252386 CTGTCGGGGCAGAGGAAAACTGG - Intronic
951738025 3:25889218-25889240 CTTTGTGACCAGAAGACAAAGGG + Intergenic
951847110 3:27096594-27096616 CTGTGTAAACACAGCAAAACCGG - Intergenic
953797904 3:45999676-45999698 GTGTGAGAACAGAGGAAAACCGG - Intergenic
955375693 3:58394771-58394793 CTGTAGGAACAAAGGAAAACAGG - Intronic
955969779 3:64426707-64426729 CTGTGTGACCAAGGTAACACAGG + Intronic
956262209 3:67356460-67356482 CTGTGTGATCTTAGGAAAGCTGG + Intergenic
956779123 3:72590614-72590636 TTGTTTGAAAAGAGGAAAACAGG + Intergenic
957938276 3:86971382-86971404 CTGTGTGACCACAGGATGAATGG - Intronic
957967299 3:87338895-87338917 CTGTGTGACCCAAGGCAAATTGG - Intergenic
958797284 3:98719171-98719193 CTGGGTGACAAGAGTGAAACTGG - Intergenic
959878219 3:111412072-111412094 GTATCTAACCAGAGGAAAACAGG + Intronic
961855572 3:129867454-129867476 CAGTGTGGAAAGAGGAAAACAGG - Intronic
962751947 3:138440106-138440128 ATGTGTCACCAGAGAAAAGCAGG - Intronic
963544213 3:146634431-146634453 CTGTGTGAACTGAAGAAAAGAGG - Intergenic
964427970 3:156573113-156573135 CTGTGAGACTAGCAGAAAACAGG - Intergenic
964637009 3:158869250-158869272 CCATGTGACCAGCTGAAAACTGG - Intergenic
966365716 3:179185360-179185382 GTGTGAGAGCAGAGGAAAAATGG - Intronic
969241304 4:5900012-5900034 CTGTCTCAACAGAGAAAAACAGG + Intronic
969590193 4:8117636-8117658 CTTTGGGGCCAGAGGAAAAGTGG - Intronic
970676622 4:18457777-18457799 CTGTGTGACCTGGGGCAAATGGG - Intergenic
971975390 4:33679477-33679499 GTATGTGACCAGAGTAAAAAGGG - Intergenic
972948910 4:44294232-44294254 CTGCGTTACCACAGGACAACAGG - Intronic
973133390 4:46676142-46676164 CTGTGGGACAAGAGGAGAAATGG - Intergenic
974733380 4:65898246-65898268 TGGTGGGATCAGAGGAAAACAGG - Intergenic
975114923 4:70669871-70669893 CAGTGAGACAGGAGGAAAACAGG - Intronic
975329799 4:73100070-73100092 GTTTGTGAACAGAGGAAAAATGG - Intronic
976472684 4:85447892-85447914 CTGTGGGACCAGATTAAAGCTGG - Intergenic
976856399 4:89609830-89609852 GTGAGTGACCAGAGGAGAAAGGG + Intergenic
977676780 4:99756895-99756917 TTGTGTGACTAGAGGGAAGCTGG + Intergenic
977785066 4:101023203-101023225 GTGTGTAACCAGAGGTACACTGG + Intergenic
979520317 4:121658574-121658596 TTGTGTGTGCAGAAGAAAACTGG - Intergenic
979772096 4:124539236-124539258 CTGTATTAACAGAGGACAACTGG + Intergenic
981616691 4:146650242-146650264 CTGTGTTTCCCGGGGAAAACAGG + Intergenic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
982690598 4:158543563-158543585 TTGTGTTAACAGAGGAAAATGGG + Intronic
983122618 4:163906231-163906253 CTCTGTGAGCAGAGAAAAATGGG - Intronic
983358672 4:166699489-166699511 CTGTGTGAACAGAAGAGAAGAGG + Intergenic
985626753 5:992956-992978 CTGTGTGCCCTGAGTAACACGGG + Intergenic
986285853 5:6358536-6358558 CTGTGTCCCCATAGGAAAGCAGG + Intergenic
986807800 5:11325311-11325333 CTTTATGGCCAGAGGAAAAAAGG - Intronic
988624157 5:32853007-32853029 CTTTGTGACCTGAGGAAATGTGG - Intergenic
991630032 5:68647377-68647399 TAGTGTGACAAGAGGAAAAGAGG - Intergenic
992556117 5:77905438-77905460 CTGTGTGGCCATACGAAAAAAGG + Intergenic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
995735789 5:115297919-115297941 CTGTGAGAAGGGAGGAAAACCGG + Intergenic
997517503 5:134501463-134501485 CTGTGGGGACAGAGGAAAAGAGG + Intergenic
998376299 5:141692961-141692983 CTGTGTGACCTTGGGAAAGCAGG + Intergenic
998674556 5:144392502-144392524 CTGTGTGACCAGATGAGAGGTGG + Intronic
999148550 5:149411896-149411918 CTGTGTGCCCAGAGGGATAATGG - Intergenic
999290470 5:150422217-150422239 CTGTGTGACAAGTGAGAAACTGG - Intergenic
999791049 5:154939606-154939628 CTAGGTGATCAGAGGAAAAAGGG + Intergenic
1000380329 5:160623148-160623170 AAGTGTGATCAGAGGAATACAGG - Intronic
1001564106 5:172688491-172688513 CTGGGTGCCCAGAGCAAAGCTGG + Exonic
1002889763 6:1322394-1322416 CTGGGTGACCTTAGGGAAACGGG + Intergenic
1003619451 6:7685138-7685160 CTGTGTGACGAGTGGAAAAACGG + Intergenic
1005102528 6:22187883-22187905 TTTTGTGACCAGAGGAACAAAGG - Intergenic
1006474548 6:34245822-34245844 GTTTGTGAACAGAGGAAAAATGG - Exonic
1008662251 6:53680170-53680192 CTGTGTGCCCGGCTGAAAACTGG - Intergenic
1009584360 6:65578911-65578933 CTGTGTGACCATAAGAGAATGGG - Intronic
1010381635 6:75232139-75232161 TTCTATAACCAGAGGAAAACAGG - Intergenic
1012581751 6:100878757-100878779 GTGTGAGAGCAGAGGAAAAACGG - Intronic
1014729755 6:125019073-125019095 CTCTGTGATCAGAGGCAAGCGGG - Intronic
1015394320 6:132717889-132717911 CTATGAGACCAGAGGAAAAATGG - Intergenic
1017543129 6:155423300-155423322 ATGTGTGACCAAATGTAAACAGG - Intronic
1017551751 6:155517049-155517071 CTGGGTGGCCACAGGAAAAACGG + Intergenic
1018641873 6:165911478-165911500 CTGTGTAACCAGATGAAAGTTGG - Intronic
1020802576 7:12749761-12749783 CTGTGGGAGAAGAAGAAAACAGG + Intergenic
1021159886 7:17259811-17259833 CTGTGTGCCCTGAGGGAGACAGG - Intergenic
1021788919 7:24180164-24180186 CTGTGTGACTAGAGGAAGACAGG - Intergenic
1022110110 7:27224797-27224819 CTGTGTGCTCACAGGCAAACAGG - Intergenic
1023168543 7:37367411-37367433 CTATGTGACCACAGGTAAAATGG - Intronic
1023238217 7:38113661-38113683 CTGTTAGACCAGAGGAAAAAAGG - Intergenic
1024548667 7:50542509-50542531 CTGTGTGATCGCAGGAAACCAGG - Intronic
1025812644 7:64884929-64884951 CTGCCTGAGCAGAGGAAAATGGG - Intronic
1028148800 7:87347982-87348004 CTGTTAAAGCAGAGGAAAACAGG + Intronic
1030068430 7:105678341-105678363 CTGTGTGCCCAGAGAAATAAAGG - Intronic
1030346417 7:108438183-108438205 TTTTGTTACCAGAGTAAAACTGG - Intronic
1030801227 7:113855748-113855770 CTGTGTGTCCAAAAGAAAATAGG + Intergenic
1032835727 7:135671518-135671540 CTTAGTTACCAGAGGAAAACAGG + Intronic
1033734859 7:144212028-144212050 CTATGTGGTCTGAGGAAAACTGG - Intergenic
1033748196 7:144338941-144338963 CTATGTGGTCTGAGGAAAACTGG + Intergenic
1035440382 7:158892276-158892298 CTGACTGACAAGAAGAAAACAGG - Intronic
1035932540 8:3798855-3798877 CTGTATGAACAAAGGAAAATAGG - Intronic
1039011325 8:33096557-33096579 CTTTCTGACCAGAGGGCAACTGG - Intergenic
1042086147 8:65111576-65111598 CTGACTGCCCAGAGGTAAACAGG + Intergenic
1044645128 8:94432944-94432966 CTGTTTGACAACATGAAAACTGG - Intronic
1047334834 8:123925528-123925550 CTGTGTGCCCAGCTGAAAATTGG + Intronic
1047551239 8:125874591-125874613 CTGTGTGAGCAAAGGCACACAGG - Intergenic
1047648157 8:126890654-126890676 TTGTGTGACCACAGGAAAGCTGG - Intergenic
1050341973 9:4649214-4649236 CTGTCTACCCAGAGGAAAAGAGG - Intronic
1050905865 9:11004738-11004760 CTCTGTGGCCAGAGGAATAAAGG + Intergenic
1051481935 9:17571009-17571031 CTGAGTGACCACATGAAAACTGG - Intergenic
1052342522 9:27377927-27377949 CTGTGAGAGCAGAGCAAGACAGG - Intronic
1052421582 9:28249894-28249916 TTGTTTGACCAAAGGAAAAATGG - Intronic
1054146827 9:61568352-61568374 CTGGGTGACAAGAGTGAAACTGG + Intergenic
1054840417 9:69732285-69732307 CTTTGTGACCAAAGGAAACTTGG - Exonic
1054918900 9:70522346-70522368 GTGTGAGAGCAGAGGAAAAATGG - Intergenic
1055399545 9:75908482-75908504 CTTTTTGACCAGAGGAAAGGGGG - Intronic
1056607521 9:88098734-88098756 CTGGGTGTCCTGAGGAAACCTGG - Intergenic
1057328395 9:94088613-94088635 CTGTGTGATCTTAGGCAAACAGG - Intronic
1057635362 9:96759922-96759944 CTCTTTGACCACAGGAGAACTGG - Exonic
1059469473 9:114493789-114493811 CAGTGTGCCCAGGGGAGAACAGG + Intronic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1060155838 9:121319126-121319148 CTGTGTGATCAGTGGAAGATGGG + Intronic
1060216196 9:121739922-121739944 CTGTGAGAACAGAGGAAAGCTGG + Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061243165 9:129386167-129386189 CTGTGTGGCCTCAGGAAAGCAGG + Intergenic
1061633047 9:131885598-131885620 AAGTGTGACCAGAGGAGGACTGG - Intronic
1062050169 9:134443074-134443096 CTGGGTGACCAGAGGAGGCCAGG + Intergenic
1186202577 X:7169232-7169254 CCCTGTGGCCAGATGAAAACAGG + Intergenic
1187833851 X:23410606-23410628 ATGTATGACCAGAGGAAGACAGG - Intergenic
1189604569 X:42662318-42662340 GTGTGGACCCAGAGGAAAACTGG - Intergenic
1199160155 X:144599768-144599790 CTGTGGGGCTAGAGTAAAACAGG - Intergenic
1202602501 Y:26608577-26608599 CTGAGAAACAAGAGGAAAACTGG - Intergenic