ID: 1125071305

View in Genome Browser
Species Human (GRCh38)
Location 15:35557127-35557149
Sequence AGCCAGCGGGACGCACTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125071305_1125071309 0 Left 1125071305 15:35557127-35557149 CCTGCCAGTGCGTCCCGCTGGCT No data
Right 1125071309 15:35557150-35557172 GAATCCCACACAAAGTTAGACGG No data
1125071305_1125071312 5 Left 1125071305 15:35557127-35557149 CCTGCCAGTGCGTCCCGCTGGCT No data
Right 1125071312 15:35557155-35557177 CCACACAAAGTTAGACGGTAAGG No data
1125071305_1125071313 6 Left 1125071305 15:35557127-35557149 CCTGCCAGTGCGTCCCGCTGGCT No data
Right 1125071313 15:35557156-35557178 CACACAAAGTTAGACGGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125071305 Original CRISPR AGCCAGCGGGACGCACTGGC AGG (reversed) Intergenic
No off target data available for this crispr