ID: 1125071748

View in Genome Browser
Species Human (GRCh38)
Location 15:35562984-35563006
Sequence CCTGGGTACTGCAACATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125071748_1125071751 -6 Left 1125071748 15:35562984-35563006 CCTTCTATGTTGCAGTACCCAGG No data
Right 1125071751 15:35563001-35563023 CCCAGGATATGTCCTATAGCAGG No data
1125071748_1125071753 1 Left 1125071748 15:35562984-35563006 CCTTCTATGTTGCAGTACCCAGG No data
Right 1125071753 15:35563008-35563030 TATGTCCTATAGCAGGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125071748 Original CRISPR CCTGGGTACTGCAACATAGA AGG (reversed) Intergenic
No off target data available for this crispr