ID: 1125076812

View in Genome Browser
Species Human (GRCh38)
Location 15:35629086-35629108
Sequence TGGAATGCCTAGAAATGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125076812_1125076818 30 Left 1125076812 15:35629086-35629108 CCTATACATTTCTAGGCATTCCA No data
Right 1125076818 15:35629139-35629161 TATTAGGGTTCCATAAACAAGGG No data
1125076812_1125076817 29 Left 1125076812 15:35629086-35629108 CCTATACATTTCTAGGCATTCCA No data
Right 1125076817 15:35629138-35629160 ATATTAGGGTTCCATAAACAAGG No data
1125076812_1125076816 15 Left 1125076812 15:35629086-35629108 CCTATACATTTCTAGGCATTCCA No data
Right 1125076816 15:35629124-35629146 AATGCAAATCAAGGATATTAGGG No data
1125076812_1125076815 14 Left 1125076812 15:35629086-35629108 CCTATACATTTCTAGGCATTCCA No data
Right 1125076815 15:35629123-35629145 CAATGCAAATCAAGGATATTAGG No data
1125076812_1125076814 6 Left 1125076812 15:35629086-35629108 CCTATACATTTCTAGGCATTCCA No data
Right 1125076814 15:35629115-35629137 CAAAGTCACAATGCAAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125076812 Original CRISPR TGGAATGCCTAGAAATGTAT AGG (reversed) Intergenic
No off target data available for this crispr