ID: 1125077689

View in Genome Browser
Species Human (GRCh38)
Location 15:35638698-35638720
Sequence GACTCTACTCCCTCTACCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125077689_1125077690 -9 Left 1125077689 15:35638698-35638720 CCAAAGGTAGAGGGAGTAGAGTC No data
Right 1125077690 15:35638712-35638734 AGTAGAGTCAGATGTGAATGTGG No data
1125077689_1125077692 3 Left 1125077689 15:35638698-35638720 CCAAAGGTAGAGGGAGTAGAGTC No data
Right 1125077692 15:35638724-35638746 TGTGAATGTGGGTGACCAAAAGG No data
1125077689_1125077691 -8 Left 1125077689 15:35638698-35638720 CCAAAGGTAGAGGGAGTAGAGTC No data
Right 1125077691 15:35638713-35638735 GTAGAGTCAGATGTGAATGTGGG No data
1125077689_1125077693 10 Left 1125077689 15:35638698-35638720 CCAAAGGTAGAGGGAGTAGAGTC No data
Right 1125077693 15:35638731-35638753 GTGGGTGACCAAAAGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125077689 Original CRISPR GACTCTACTCCCTCTACCTT TGG (reversed) Intergenic
No off target data available for this crispr