ID: 1125083380

View in Genome Browser
Species Human (GRCh38)
Location 15:35701609-35701631
Sequence AGGATATAGGAGAAACTATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125083380_1125083384 -8 Left 1125083380 15:35701609-35701631 CCGCATAGTTTCTCCTATATCCT No data
Right 1125083384 15:35701624-35701646 TATATCCTATTCAAGGAAAAGGG No data
1125083380_1125083386 0 Left 1125083380 15:35701609-35701631 CCGCATAGTTTCTCCTATATCCT No data
Right 1125083386 15:35701632-35701654 ATTCAAGGAAAAGGGAACAGTGG No data
1125083380_1125083383 -9 Left 1125083380 15:35701609-35701631 CCGCATAGTTTCTCCTATATCCT No data
Right 1125083383 15:35701623-35701645 CTATATCCTATTCAAGGAAAAGG No data
1125083380_1125083387 26 Left 1125083380 15:35701609-35701631 CCGCATAGTTTCTCCTATATCCT No data
Right 1125083387 15:35701658-35701680 CTCCAAGAATAAAAATAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125083380 Original CRISPR AGGATATAGGAGAAACTATG CGG (reversed) Intergenic
No off target data available for this crispr