ID: 1125083382

View in Genome Browser
Species Human (GRCh38)
Location 15:35701622-35701644
Sequence CTTTTCCTTGAATAGGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125083382_1125083387 13 Left 1125083382 15:35701622-35701644 CCTATATCCTATTCAAGGAAAAG No data
Right 1125083387 15:35701658-35701680 CTCCAAGAATAAAAATAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125083382 Original CRISPR CTTTTCCTTGAATAGGATAT AGG (reversed) Intergenic
No off target data available for this crispr