ID: 1125083387

View in Genome Browser
Species Human (GRCh38)
Location 15:35701658-35701680
Sequence CTCCAAGAATAAAAATAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125083382_1125083387 13 Left 1125083382 15:35701622-35701644 CCTATATCCTATTCAAGGAAAAG No data
Right 1125083387 15:35701658-35701680 CTCCAAGAATAAAAATAATAAGG No data
1125083385_1125083387 6 Left 1125083385 15:35701629-35701651 CCTATTCAAGGAAAAGGGAACAG No data
Right 1125083387 15:35701658-35701680 CTCCAAGAATAAAAATAATAAGG No data
1125083380_1125083387 26 Left 1125083380 15:35701609-35701631 CCGCATAGTTTCTCCTATATCCT No data
Right 1125083387 15:35701658-35701680 CTCCAAGAATAAAAATAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125083387 Original CRISPR CTCCAAGAATAAAAATAATA AGG Intergenic
No off target data available for this crispr