ID: 1125095197

View in Genome Browser
Species Human (GRCh38)
Location 15:35842534-35842556
Sequence TGGGAATCCCTATGCTTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125095197_1125095205 15 Left 1125095197 15:35842534-35842556 CCTCTTAAGCATAGGGATTCCCA No data
Right 1125095205 15:35842572-35842594 CTTGCTTTTCTCTCTGTTTGGGG No data
1125095197_1125095204 14 Left 1125095197 15:35842534-35842556 CCTCTTAAGCATAGGGATTCCCA No data
Right 1125095204 15:35842571-35842593 CCTTGCTTTTCTCTCTGTTTGGG No data
1125095197_1125095202 13 Left 1125095197 15:35842534-35842556 CCTCTTAAGCATAGGGATTCCCA No data
Right 1125095202 15:35842570-35842592 CCCTTGCTTTTCTCTCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125095197 Original CRISPR TGGGAATCCCTATGCTTAAG AGG (reversed) Intergenic
No off target data available for this crispr