ID: 1125095424

View in Genome Browser
Species Human (GRCh38)
Location 15:35844763-35844785
Sequence CAGTTTCCCTTTAAGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125095420_1125095424 4 Left 1125095420 15:35844736-35844758 CCTACATTTCTTATCTGCCACAA No data
Right 1125095424 15:35844763-35844785 CAGTTTCCCTTTAAGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125095424 Original CRISPR CAGTTTCCCTTTAAGGAACT GGG Intergenic
No off target data available for this crispr