ID: 1125098125

View in Genome Browser
Species Human (GRCh38)
Location 15:35878216-35878238
Sequence CAGGGTCCACAAGCCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125098121_1125098125 -10 Left 1125098121 15:35878203-35878225 CCAATGTCCCTGCCAGGGTCCAC No data
Right 1125098125 15:35878216-35878238 CAGGGTCCACAAGCCCTGCCTGG No data
1125098118_1125098125 22 Left 1125098118 15:35878171-35878193 CCAGTGGTGTTCTGTCTCACTCA No data
Right 1125098125 15:35878216-35878238 CAGGGTCCACAAGCCCTGCCTGG No data
1125098116_1125098125 26 Left 1125098116 15:35878167-35878189 CCCTCCAGTGGTGTTCTGTCTCA No data
Right 1125098125 15:35878216-35878238 CAGGGTCCACAAGCCCTGCCTGG No data
1125098117_1125098125 25 Left 1125098117 15:35878168-35878190 CCTCCAGTGGTGTTCTGTCTCAC No data
Right 1125098125 15:35878216-35878238 CAGGGTCCACAAGCCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125098125 Original CRISPR CAGGGTCCACAAGCCCTGCC TGG Intergenic