ID: 1125098733

View in Genome Browser
Species Human (GRCh38)
Location 15:35885347-35885369
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125098733_1125098736 1 Left 1125098733 15:35885347-35885369 CCCCTCTGTTTATGCTGTTACAT No data
Right 1125098736 15:35885371-35885393 TTCTACTTTCCAGTTTACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125098733 Original CRISPR ATGTAACAGCATAAACAGAG GGG (reversed) Intergenic
No off target data available for this crispr