ID: 1125098736

View in Genome Browser
Species Human (GRCh38)
Location 15:35885371-35885393
Sequence TTCTACTTTCCAGTTTACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125098735_1125098736 -1 Left 1125098735 15:35885349-35885371 CCTCTGTTTATGCTGTTACATTT No data
Right 1125098736 15:35885371-35885393 TTCTACTTTCCAGTTTACCTAGG No data
1125098728_1125098736 28 Left 1125098728 15:35885320-35885342 CCCTCTTCCTTACCCATCTCTCA No data
Right 1125098736 15:35885371-35885393 TTCTACTTTCCAGTTTACCTAGG No data
1125098733_1125098736 1 Left 1125098733 15:35885347-35885369 CCCCTCTGTTTATGCTGTTACAT No data
Right 1125098736 15:35885371-35885393 TTCTACTTTCCAGTTTACCTAGG No data
1125098731_1125098736 16 Left 1125098731 15:35885332-35885354 CCCATCTCTCAAAAGCCCCTCTG No data
Right 1125098736 15:35885371-35885393 TTCTACTTTCCAGTTTACCTAGG No data
1125098726_1125098736 30 Left 1125098726 15:35885318-35885340 CCCCCTCTTCCTTACCCATCTCT No data
Right 1125098736 15:35885371-35885393 TTCTACTTTCCAGTTTACCTAGG No data
1125098732_1125098736 15 Left 1125098732 15:35885333-35885355 CCATCTCTCAAAAGCCCCTCTGT No data
Right 1125098736 15:35885371-35885393 TTCTACTTTCCAGTTTACCTAGG No data
1125098729_1125098736 27 Left 1125098729 15:35885321-35885343 CCTCTTCCTTACCCATCTCTCAA No data
Right 1125098736 15:35885371-35885393 TTCTACTTTCCAGTTTACCTAGG No data
1125098734_1125098736 0 Left 1125098734 15:35885348-35885370 CCCTCTGTTTATGCTGTTACATT No data
Right 1125098736 15:35885371-35885393 TTCTACTTTCCAGTTTACCTAGG No data
1125098730_1125098736 21 Left 1125098730 15:35885327-35885349 CCTTACCCATCTCTCAAAAGCCC No data
Right 1125098736 15:35885371-35885393 TTCTACTTTCCAGTTTACCTAGG No data
1125098727_1125098736 29 Left 1125098727 15:35885319-35885341 CCCCTCTTCCTTACCCATCTCTC No data
Right 1125098736 15:35885371-35885393 TTCTACTTTCCAGTTTACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125098736 Original CRISPR TTCTACTTTCCAGTTTACCT AGG Intergenic
No off target data available for this crispr