ID: 1125101822

View in Genome Browser
Species Human (GRCh38)
Location 15:35922556-35922578
Sequence TGTGCCTTAGGGCACTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125101822_1125101827 6 Left 1125101822 15:35922556-35922578 CCACCACAGTGCCCTAAGGCACA No data
Right 1125101827 15:35922585-35922607 TATAGCCATTCACACATGCACGG No data
1125101822_1125101829 15 Left 1125101822 15:35922556-35922578 CCACCACAGTGCCCTAAGGCACA No data
Right 1125101829 15:35922594-35922616 TCACACATGCACGGTCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125101822 Original CRISPR TGTGCCTTAGGGCACTGTGG TGG (reversed) Intergenic
No off target data available for this crispr