ID: 1125108574

View in Genome Browser
Species Human (GRCh38)
Location 15:36003775-36003797
Sequence TCCCCAAAATGTCCATGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125108571_1125108574 9 Left 1125108571 15:36003743-36003765 CCACTCATAATGAAATGATGATA No data
Right 1125108574 15:36003775-36003797 TCCCCAAAATGTCCATGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125108574 Original CRISPR TCCCCAAAATGTCCATGAGC AGG Intergenic
No off target data available for this crispr