ID: 1125114471

View in Genome Browser
Species Human (GRCh38)
Location 15:36073243-36073265
Sequence ATGACCTATATAAATTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125114471_1125114474 -9 Left 1125114471 15:36073243-36073265 CCTCCTTAATTTATATAGGTCAT No data
Right 1125114474 15:36073257-36073279 ATAGGTCATTACTATGTGGCTGG No data
1125114471_1125114475 -8 Left 1125114471 15:36073243-36073265 CCTCCTTAATTTATATAGGTCAT No data
Right 1125114475 15:36073258-36073280 TAGGTCATTACTATGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125114471 Original CRISPR ATGACCTATATAAATTAAGG AGG (reversed) Intergenic
No off target data available for this crispr