ID: 1125126087

View in Genome Browser
Species Human (GRCh38)
Location 15:36222231-36222253
Sequence CAGGCCAGACTCAGACCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125126081_1125126087 22 Left 1125126081 15:36222186-36222208 CCTCATTCTTCTTGGGCGTGGGA No data
Right 1125126087 15:36222231-36222253 CAGGCCAGACTCAGACCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125126087 Original CRISPR CAGGCCAGACTCAGACCAGG TGG Intergenic
No off target data available for this crispr