ID: 1125126148

View in Genome Browser
Species Human (GRCh38)
Location 15:36223381-36223403
Sequence GTGGACCAGCAAATGAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125126146_1125126148 -5 Left 1125126146 15:36223363-36223385 CCTTGGGATCCAGGCTGGGTGGA No data
Right 1125126148 15:36223381-36223403 GTGGACCAGCAAATGAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125126148 Original CRISPR GTGGACCAGCAAATGAACTC AGG Intergenic
No off target data available for this crispr