ID: 1125130423

View in Genome Browser
Species Human (GRCh38)
Location 15:36278501-36278523
Sequence TGGGAGGGGCTTTATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125130410_1125130423 9 Left 1125130410 15:36278469-36278491 CCCCTGCTCCCTCTGTGGGAAGA No data
Right 1125130423 15:36278501-36278523 TGGGAGGGGCTTTATGAGGCAGG No data
1125130416_1125130423 0 Left 1125130416 15:36278478-36278500 CCTCTGTGGGAAGAGGGTCACTA No data
Right 1125130423 15:36278501-36278523 TGGGAGGGGCTTTATGAGGCAGG No data
1125130412_1125130423 7 Left 1125130412 15:36278471-36278493 CCTGCTCCCTCTGTGGGAAGAGG No data
Right 1125130423 15:36278501-36278523 TGGGAGGGGCTTTATGAGGCAGG No data
1125130411_1125130423 8 Left 1125130411 15:36278470-36278492 CCCTGCTCCCTCTGTGGGAAGAG No data
Right 1125130423 15:36278501-36278523 TGGGAGGGGCTTTATGAGGCAGG No data
1125130415_1125130423 1 Left 1125130415 15:36278477-36278499 CCCTCTGTGGGAAGAGGGTCACT No data
Right 1125130423 15:36278501-36278523 TGGGAGGGGCTTTATGAGGCAGG No data
1125130409_1125130423 10 Left 1125130409 15:36278468-36278490 CCCCCTGCTCCCTCTGTGGGAAG No data
Right 1125130423 15:36278501-36278523 TGGGAGGGGCTTTATGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125130423 Original CRISPR TGGGAGGGGCTTTATGAGGC AGG Intergenic
No off target data available for this crispr