ID: 1125133682

View in Genome Browser
Species Human (GRCh38)
Location 15:36314964-36314986
Sequence TCTTGCAAACAGACTCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125133682_1125133686 4 Left 1125133682 15:36314964-36314986 CCCATCTGAGTCTGTTTGCAAGA No data
Right 1125133686 15:36314991-36315013 AGATTTTCATTGGGATAATCTGG No data
1125133682_1125133689 21 Left 1125133682 15:36314964-36314986 CCCATCTGAGTCTGTTTGCAAGA No data
Right 1125133689 15:36315008-36315030 ATCTGGGGATATTTTTATCCAGG No data
1125133682_1125133685 -5 Left 1125133682 15:36314964-36314986 CCCATCTGAGTCTGTTTGCAAGA No data
Right 1125133685 15:36314982-36315004 CAAGAAAGAAGATTTTCATTGGG No data
1125133682_1125133688 6 Left 1125133682 15:36314964-36314986 CCCATCTGAGTCTGTTTGCAAGA No data
Right 1125133688 15:36314993-36315015 ATTTTCATTGGGATAATCTGGGG No data
1125133682_1125133684 -6 Left 1125133682 15:36314964-36314986 CCCATCTGAGTCTGTTTGCAAGA No data
Right 1125133684 15:36314981-36315003 GCAAGAAAGAAGATTTTCATTGG No data
1125133682_1125133687 5 Left 1125133682 15:36314964-36314986 CCCATCTGAGTCTGTTTGCAAGA No data
Right 1125133687 15:36314992-36315014 GATTTTCATTGGGATAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125133682 Original CRISPR TCTTGCAAACAGACTCAGAT GGG (reversed) Intergenic
No off target data available for this crispr