ID: 1125137350

View in Genome Browser
Species Human (GRCh38)
Location 15:36358981-36359003
Sequence GCATATGCAACATGGGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125137350_1125137355 -5 Left 1125137350 15:36358981-36359003 CCAAATGCCCATGTTGCATATGC No data
Right 1125137355 15:36358999-36359021 TATGCCATAGGGAGATTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125137350 Original CRISPR GCATATGCAACATGGGCATT TGG (reversed) Intergenic
No off target data available for this crispr