ID: 1125139847

View in Genome Browser
Species Human (GRCh38)
Location 15:36392787-36392809
Sequence CAGGCTTAGGAATATGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125139847_1125139851 26 Left 1125139847 15:36392787-36392809 CCACAGACATATTCCTAAGCCTG No data
Right 1125139851 15:36392836-36392858 AAGTGCGACAGAAGAATTTCTGG No data
1125139847_1125139852 27 Left 1125139847 15:36392787-36392809 CCACAGACATATTCCTAAGCCTG No data
Right 1125139852 15:36392837-36392859 AGTGCGACAGAAGAATTTCTGGG No data
1125139847_1125139853 30 Left 1125139847 15:36392787-36392809 CCACAGACATATTCCTAAGCCTG No data
Right 1125139853 15:36392840-36392862 GCGACAGAAGAATTTCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125139847 Original CRISPR CAGGCTTAGGAATATGTCTG TGG (reversed) Intergenic
No off target data available for this crispr