ID: 1125143694

View in Genome Browser
Species Human (GRCh38)
Location 15:36440643-36440665
Sequence CCCATGAGTGATGCCTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125143694_1125143702 28 Left 1125143694 15:36440643-36440665 CCCCATCAGGCATCACTCATGGG 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1125143702 15:36440694-36440716 TCAAAAGTCAGATATCCACGTGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125143694 Original CRISPR CCCATGAGTGATGCCTGATG GGG (reversed) Intergenic
902761426 1:18583403-18583425 CCCGTGACTGAGGCCAGATGTGG - Intergenic
909542957 1:76811321-76811343 CCCATCAGTCATGCCTAATTAGG - Intergenic
915488050 1:156235824-156235846 CCCATAAGTGTTGGCTGATCTGG - Intronic
919869341 1:201808758-201808780 CCCTGGAGTGGAGCCTGATGAGG - Exonic
920371023 1:205479482-205479504 CCCAGGTGTGATGGCTCATGGGG - Intergenic
1065891535 10:30125484-30125506 CCCATGATTAGTGGCTGATGGGG + Intergenic
1067532833 10:47086837-47086859 GCCATGAGTCCTGCCTGTTGGGG + Intergenic
1068590000 10:58843701-58843723 CCCCTGAGTTAAACCTGATGAGG + Intergenic
1069832499 10:71289789-71289811 CCCAAGAGTGAGGGCTGCTGAGG + Intronic
1070996387 10:80786890-80786912 TCAGTGAGTGAGGCCTGATGTGG + Intergenic
1073606630 10:104902145-104902167 CCCATGAGTTATGGTTGATTGGG - Intronic
1075304398 10:121355020-121355042 CCCATGAGTGATCCTGGAGGTGG - Intergenic
1076074833 10:127525061-127525083 ACAATGAGTGATTCCTGCTGTGG + Intergenic
1081680168 11:44996993-44997015 CTAATGAGTGATGCCTGCTGTGG + Intergenic
1085289735 11:75389223-75389245 CCCCTGCATGACGCCTGATGGGG + Intergenic
1088042043 11:105398035-105398057 ACCATGATTGATGTCTGATCAGG - Intergenic
1091386395 12:98617-98639 CCAAGGAGTGGTGCTTGATGAGG - Intronic
1094384761 12:29882025-29882047 CCCATGAGTGATGCTGGCTTAGG + Intergenic
1096815000 12:54196288-54196310 TCCATGAGAGATGGCTGCTGGGG - Intergenic
1103741752 12:123095949-123095971 CCCATGACTGATGCCTGTGATGG + Intronic
1104160458 12:126174762-126174784 ACCATGAGTTATCCCTGTTGAGG + Intergenic
1104634071 12:130426866-130426888 CCCATGAGTCAGGCCCGGTGAGG - Intronic
1104997143 12:132665081-132665103 TCCATGAGTGATGCGTGCTGTGG - Intronic
1112478342 13:99752435-99752457 CACATGAGTGATACCAGCTGGGG + Intronic
1117336394 14:54760287-54760309 CCCATCAGTGAGGGCTGACGCGG - Exonic
1118952473 14:70446963-70446985 CCCAAGAGTGATGGGTGTTGGGG + Intergenic
1119178268 14:72585785-72585807 CCCATGAGGGATGAGTGCTGAGG + Intergenic
1120250188 14:82053774-82053796 CCAATGAGTGGAGCGTGATGTGG - Intergenic
1122599409 14:102913812-102913834 CAGATGAGTGATGCCGGAAGGGG + Intergenic
1122877611 14:104676176-104676198 CCTTTGAGTGATGCCTGGTTGGG - Intergenic
1122914540 14:104852051-104852073 CTCCTGAGTGAGGCCTGCTGCGG - Intergenic
1123010961 14:105349284-105349306 CCCATGAGTGGTGCCGGCTAGGG - Intronic
1123025159 14:105420575-105420597 CCCCTGAGGGATCCCTGCTGGGG - Intronic
1123940844 15:25215937-25215959 GCCATGAGTGATGCAGCATGGGG + Intergenic
1123943407 15:25227503-25227525 GCCATGAGTGATGCAGCATGGGG + Intergenic
1124362360 15:29046916-29046938 TCCAGGAGAGATGCCTGATGAGG - Intronic
1125143694 15:36440643-36440665 CCCATGAGTGATGCCTGATGGGG - Intergenic
1129101203 15:73265784-73265806 CTCATGAGCCATGCCTCATGTGG - Intronic
1129616608 15:77103973-77103995 CCAAGGAGTGCTTCCTGATGTGG - Exonic
1129786994 15:78316212-78316234 CCCATAAGTCATTTCTGATGGGG - Intergenic
1133790708 16:9007446-9007468 CCAATGCATGATGCCAGATGTGG + Intergenic
1134682212 16:16134246-16134268 CAGATGACTGATGCCTGAGGTGG + Intronic
1134812316 16:17178181-17178203 CCCATCAGTGTTGCCTGACCAGG - Intronic
1135706167 16:24677017-24677039 CCCAGAAGTGATGCCTGAATTGG - Intergenic
1141590026 16:85062235-85062257 GCCATGAGTGAGACCTTATGGGG - Intronic
1144946679 17:18973007-18973029 CCCATGAGGCATGGCGGATGTGG - Intronic
1147611100 17:41802229-41802251 CCCATGGGTGAGGCAGGATGGGG + Exonic
1147676724 17:42211620-42211642 CCCATGTGTAATGCCAGATCAGG - Intronic
1148131711 17:45266335-45266357 CCCATGAGCCTTTCCTGATGGGG - Intronic
1153812749 18:8766238-8766260 CCAAAGAATGATGCCTCATGAGG + Intronic
1156915245 18:42458426-42458448 CCACTGAGACATGCCTGATGTGG - Intergenic
1158483521 18:57843885-57843907 CCCATGAGTGAGCCTTGAAGGGG + Intergenic
1159217447 18:65413026-65413048 CCCTTGAGTGTTGCCTGAACAGG - Intergenic
1161680555 19:5677808-5677830 CCCAGGGCTCATGCCTGATGCGG + Intronic
1163739802 19:19004414-19004436 CCCAGAGGTGATGCCTGAGGAGG - Exonic
1164120076 19:22258027-22258049 CACATGGTTGATGGCTGATGTGG - Intergenic
1165304856 19:34997259-34997281 ACCATGCGTGAGGCCTAATGAGG + Intronic
1167713789 19:51127955-51127977 CCCCTGAGTCACTCCTGATGTGG - Exonic
925413511 2:3653875-3653897 CCCAGCAGGGAAGCCTGATGGGG - Intergenic
925608369 2:5682536-5682558 CCCAGGAGAGAGGCCTGGTGGGG - Intergenic
926679736 2:15654239-15654261 CCCATGAAAGGTGCCTGAGGAGG + Intergenic
927895402 2:26778491-26778513 CCCATCAATGATGCCAGCTGAGG + Exonic
934892157 2:98080096-98080118 TCCATGAGTGAGGCCTAAGGGGG + Intergenic
936385148 2:112022546-112022568 CCCAGGAGCCATTCCTGATGTGG + Intronic
938582646 2:132661129-132661151 CCTAAGAGTGAGGCCAGATGTGG + Intronic
939215816 2:139236964-139236986 CCTATGTGTGATGCCAGCTGAGG - Intergenic
946360546 2:219216941-219216963 CCCACAAGTGATCCTTGATGGGG + Intronic
946404607 2:219485531-219485553 GCCATGACTGCTCCCTGATGGGG - Intronic
947069370 2:226269893-226269915 CTTATGAGTGATGACTGATAAGG + Intergenic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
948260531 2:236601161-236601183 CCCAGGAGTGAAGCGTCATGAGG + Intergenic
1170985211 20:21251597-21251619 CCCATGAGTCATGACTCGTGTGG + Intergenic
1171941997 20:31339154-31339176 CCCATGATTGGTCCCTGAAGAGG + Intergenic
1172779622 20:37428354-37428376 CCCATCAGCAGTGCCTGATGAGG + Intergenic
1173620577 20:44432740-44432762 CCCATCACTGCCGCCTGATGGGG + Exonic
1175422068 20:58840826-58840848 TCCATTAGTGACGCCGGATGGGG - Intronic
1175950331 20:62580273-62580295 CCCATGAGTGAGGTTTGCTGGGG + Intergenic
1179169506 21:38962097-38962119 CACAAGAGTGATCCCTGATCTGG + Intergenic
1179361001 21:40708653-40708675 CACAGGAGGGATGCCTGCTGCGG + Exonic
1180086105 21:45508625-45508647 CTCAGGAGTGAGGCCTGATGTGG + Intronic
1181063099 22:20291317-20291339 CCCAAGACTGATGCCAGCTGGGG + Intergenic
1182652850 22:31866103-31866125 CCCATGGGGGATGCCTGTGGTGG + Intronic
1184068300 22:42132709-42132731 TCCATGAGTGGTACTTGATGTGG + Intergenic
1184766278 22:46574193-46574215 CCCAGGAGTGAGGCCTCAGGAGG - Intergenic
950434327 3:12969489-12969511 ACCATGACAGATGCCAGATGTGG - Intronic
953119394 3:40025152-40025174 CACATGAGTGCTGTCTGATAAGG - Intronic
968661055 4:1798962-1798984 TCCATGAGTGAAGCATCATGGGG + Intronic
970227752 4:13877614-13877636 CCCAAGAGTCATCCCTGCTGGGG - Intergenic
970387989 4:15575960-15575982 CCCGTGAGGGATGCCTAGTGTGG - Intronic
986192784 5:5512196-5512218 CTCATGAGGGTAGCCTGATGTGG - Intergenic
987777106 5:22382450-22382472 ACCATGAGTGTTGCATCATGAGG + Intronic
997392065 5:133525253-133525275 GCCAAGCGTGATGCTTGATGAGG + Intronic
998524331 5:142828642-142828664 CACATGGTTGATGCCTCATGGGG - Intronic
1000368418 5:160511917-160511939 TCCATTAGTGATGTCTGATGTGG + Intergenic
1003026932 6:2563467-2563489 CCCACGAGTGTTGCCTAATTGGG + Intergenic
1006069907 6:31490821-31490843 CCCAGGAGGGATGGCTGGTGGGG - Intergenic
1006397337 6:33795872-33795894 CCCATGAGAAAAGCCTGCTGGGG - Intronic
1007712562 6:43833934-43833956 CTCATTAGTGATGTCTGCTGGGG - Intergenic
1010931130 6:81804701-81804723 CCAATGAGTGTTGTCTGGTGTGG - Intergenic
1013091730 6:106906350-106906372 CCCATGACAGATGCCAGCTGGGG + Intergenic
1015982777 6:138856085-138856107 CCTAAGAGGGATGCCTGAAGTGG - Intronic
1016332215 6:142965454-142965476 CCAAAGAATGATGCCTGGTGAGG - Intergenic
1017152730 6:151295486-151295508 CCCAGGAGTGCTGCTTGGTGAGG - Intronic
1019380918 7:723012-723034 CCCATGGGTGCTGCCTGCAGGGG + Intronic
1021264991 7:18509172-18509194 CACATGCTTGATGCCTCATGGGG + Intronic
1024479731 7:49851319-49851341 CCCATGAATGAGGCCTTATTTGG - Intronic
1029198677 7:98824323-98824345 GACATGGCTGATGCCTGATGTGG - Intergenic
1031865326 7:127032439-127032461 CCCAGGAGTGTGACCTGATGGGG - Intronic
1032114207 7:129103182-129103204 CAGATGATTGATGCCTGCTGGGG - Intergenic
1032600327 7:133286933-133286955 CCCATGTGTGTGGCTTGATGGGG + Intronic
1032796386 7:135279822-135279844 GCTATCAGTGTTGCCTGATGTGG + Intergenic
1032843972 7:135736980-135737002 ACCATGAGTGACCCCTGCTGTGG - Intronic
1035044602 7:155955382-155955404 CCCCTGATCGATGCCTGCTGCGG + Intergenic
1035359640 7:158302328-158302350 ACCATCAGTGATCCCTCATGTGG + Intronic
1036205658 8:6803968-6803990 CCCTTGAGTGAGGCAGGATGTGG - Intergenic
1048794559 8:138137993-138138015 CCAATGTGTGATGTCTGATGAGG - Intronic
1049373105 8:142277078-142277100 CCCAGGGCTGATGGCTGATGAGG - Intronic
1049720317 8:144112564-144112586 CACAAGAGTGATGCCTGGAGAGG - Intronic
1057650505 9:96915733-96915755 CCCATTAGTGATGATTCATGTGG + Intronic
1058987176 9:110219214-110219236 AGAATGAATGATGCCTGATGTGG + Intergenic
1061507899 9:131042180-131042202 TCCATGAGTGATGTCTGCTGTGG - Intronic
1061507922 9:131042358-131042380 ACCATTAGTGATGTCTGCTGTGG - Intronic
1061507946 9:131042536-131042558 ACCATTAGTGATGTCTGCTGTGG - Intronic
1061507958 9:131042614-131042636 TCCATTAGTGATGCCTGCTGTGG - Intronic
1061507981 9:131042812-131042834 GCCATTAGTGATGTCTGTTGTGG - Intronic
1061507994 9:131042890-131042912 TCCATTAGTGATGTCTGCTGTGG - Intronic
1061508013 9:131043016-131043038 CCCATTAGTGATGTCTGTTGTGG - Intronic
1061786411 9:133031098-133031120 CCCGGGAGTGGTGCGTGATGTGG + Exonic
1061920764 9:133781143-133781165 CCGCTTAGTGATGCCTGCTGGGG + Intronic
1185614662 X:1413504-1413526 CCCAGGAGGGTTGCCTGTTGCGG + Intronic
1185659310 X:1714330-1714352 CCCATCAGCGAGGGCTGATGAGG - Intergenic
1185690168 X:2148293-2148315 CCCATGAGTGAGGCATGGTTAGG + Intergenic
1185704711 X:2258088-2258110 CCCAGGAGAGAGGCCTGAGGAGG + Intronic
1185721460 X:2385428-2385450 TCAATTAGTGATGCCTGCTGTGG - Intronic
1188407833 X:29833781-29833803 TCCATTAGTGATGCCTGCTATGG + Intronic
1189212821 X:39299214-39299236 TCCATGAGGGATCCCTGAAGCGG - Intergenic
1201234960 Y:11900332-11900354 CCCAGGAGAGATGCCTAAGGAGG - Intergenic
1201888811 Y:18919103-18919125 CTCATGTCTGATGCATGATGTGG + Intergenic