ID: 1125146060

View in Genome Browser
Species Human (GRCh38)
Location 15:36469982-36470004
Sequence CAGGCAGAGCTGCTACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125146055_1125146060 6 Left 1125146055 15:36469953-36469975 CCAATTAATAAAGTAGTCTACCC No data
Right 1125146060 15:36469982-36470004 CAGGCAGAGCTGCTACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125146060 Original CRISPR CAGGCAGAGCTGCTACAAGC AGG Intergenic
No off target data available for this crispr