ID: 1125147979

View in Genome Browser
Species Human (GRCh38)
Location 15:36494836-36494858
Sequence GAACAATCTGGAGCCCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125147979_1125147985 17 Left 1125147979 15:36494836-36494858 CCCTTGGGGGCTCCAGATTGTTC No data
Right 1125147985 15:36494876-36494898 TCACCATATGGCACAGCAAGTGG No data
1125147979_1125147986 18 Left 1125147979 15:36494836-36494858 CCCTTGGGGGCTCCAGATTGTTC No data
Right 1125147986 15:36494877-36494899 CACCATATGGCACAGCAAGTGGG No data
1125147979_1125147982 5 Left 1125147979 15:36494836-36494858 CCCTTGGGGGCTCCAGATTGTTC No data
Right 1125147982 15:36494864-36494886 GCAGATCCCAATTCACCATATGG No data
1125147979_1125147989 28 Left 1125147979 15:36494836-36494858 CCCTTGGGGGCTCCAGATTGTTC No data
Right 1125147989 15:36494887-36494909 CACAGCAAGTGGGCAATAGAGGG No data
1125147979_1125147988 27 Left 1125147979 15:36494836-36494858 CCCTTGGGGGCTCCAGATTGTTC No data
Right 1125147988 15:36494886-36494908 GCACAGCAAGTGGGCAATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125147979 Original CRISPR GAACAATCTGGAGCCCCCAA GGG (reversed) Intergenic