ID: 1125147980

View in Genome Browser
Species Human (GRCh38)
Location 15:36494837-36494859
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125147980_1125147989 27 Left 1125147980 15:36494837-36494859 CCTTGGGGGCTCCAGATTGTTCT No data
Right 1125147989 15:36494887-36494909 CACAGCAAGTGGGCAATAGAGGG No data
1125147980_1125147985 16 Left 1125147980 15:36494837-36494859 CCTTGGGGGCTCCAGATTGTTCT No data
Right 1125147985 15:36494876-36494898 TCACCATATGGCACAGCAAGTGG No data
1125147980_1125147988 26 Left 1125147980 15:36494837-36494859 CCTTGGGGGCTCCAGATTGTTCT No data
Right 1125147988 15:36494886-36494908 GCACAGCAAGTGGGCAATAGAGG No data
1125147980_1125147986 17 Left 1125147980 15:36494837-36494859 CCTTGGGGGCTCCAGATTGTTCT No data
Right 1125147986 15:36494877-36494899 CACCATATGGCACAGCAAGTGGG No data
1125147980_1125147982 4 Left 1125147980 15:36494837-36494859 CCTTGGGGGCTCCAGATTGTTCT No data
Right 1125147982 15:36494864-36494886 GCAGATCCCAATTCACCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125147980 Original CRISPR AGAACAATCTGGAGCCCCCA AGG (reversed) Intergenic