ID: 1125147982

View in Genome Browser
Species Human (GRCh38)
Location 15:36494864-36494886
Sequence GCAGATCCCAATTCACCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125147975_1125147982 20 Left 1125147975 15:36494821-36494843 CCACTCTCTGATTTGCCCTTGGG No data
Right 1125147982 15:36494864-36494886 GCAGATCCCAATTCACCATATGG No data
1125147980_1125147982 4 Left 1125147980 15:36494837-36494859 CCTTGGGGGCTCCAGATTGTTCT No data
Right 1125147982 15:36494864-36494886 GCAGATCCCAATTCACCATATGG No data
1125147981_1125147982 -7 Left 1125147981 15:36494848-36494870 CCAGATTGTTCTCTGAGCAGATC No data
Right 1125147982 15:36494864-36494886 GCAGATCCCAATTCACCATATGG No data
1125147973_1125147982 24 Left 1125147973 15:36494817-36494839 CCAACCACTCTCTGATTTGCCCT No data
Right 1125147982 15:36494864-36494886 GCAGATCCCAATTCACCATATGG No data
1125147979_1125147982 5 Left 1125147979 15:36494836-36494858 CCCTTGGGGGCTCCAGATTGTTC No data
Right 1125147982 15:36494864-36494886 GCAGATCCCAATTCACCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125147982 Original CRISPR GCAGATCCCAATTCACCATA TGG Intergenic