ID: 1125147983

View in Genome Browser
Species Human (GRCh38)
Location 15:36494870-36494892
Sequence GCTGTGCCATATGGTGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125147983_1125147989 -6 Left 1125147983 15:36494870-36494892 CCCAATTCACCATATGGCACAGC No data
Right 1125147989 15:36494887-36494909 CACAGCAAGTGGGCAATAGAGGG No data
1125147983_1125147993 27 Left 1125147983 15:36494870-36494892 CCCAATTCACCATATGGCACAGC No data
Right 1125147993 15:36494920-36494942 CCAGCACTCCTGTTTCCAGATGG No data
1125147983_1125147988 -7 Left 1125147983 15:36494870-36494892 CCCAATTCACCATATGGCACAGC No data
Right 1125147988 15:36494886-36494908 GCACAGCAAGTGGGCAATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125147983 Original CRISPR GCTGTGCCATATGGTGAATT GGG (reversed) Intergenic